GenePrediction:GLEAN_7005 Details

Name: GLEAN_7005
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:360211..356585 (- strand)
Length: 3627
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:360211..360111 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_108:360038..356585 (- strand)
Length: 3454
>GLEAN_7005 class=GenePrediction position=GCSC_108:360211..356585 (- strand)
ATGACCAGCCTGACCCAGCCCCCTCTTCCGGCACCTAAGCAGATTCGCTTTGTCAATAACCAGGGCCAGCCCCCGTCTAA
ACGACGGCGAATCAATGCTGCGTGAGTTGTGTCGCCCCTTCTTCCGGACAGAAGAGTTTGTTTTAACCAATGCTCTGTTG
CTTCCGTGTACAGATGCTTGACGTGCCGGAAAAGGAAAACCCGATGTGCTGGCGAACGGCCGGCCTGCTCAACGTGTGAG
AAGAACGGCCATAAATGTCTGGGATATCCAGATCTCGTTGAGAAAAAGGATAGTGCCAGCAGCGAAGACGGTGCCAGTAG
CCATGTTCATCCTACTTCTGGTCCTCGCACAGCCTTCCAGGAGAGAAGCACGGAGGGTACTGTCAAACAAGAAGAACCCG
AATTTGCTGAGGACGAGGCCCGCAGCAATAGAAGAGTGGACATCGATACCAACCGCGACTTTGTCGACCGGGACGATGGT
GAGGGGGATTTGGCCCACAGACTGAGAGATGCAACCATTGGGACGACAGAACCATCATACCTACAGCGTGACCCTGTCTT
GAGCCTCGCAACTCCCACATCAAGACCGGGAACAGGAAGCTCTGCTGCTGACCGGAGGCCGGCGACACAGACGCACAAAT
GGCACCAGCAAAATGAGCGCAGACGCAGGTCTAACTATCGGCGTTCTGTCTCTCTCAATGACGACAGCTCCGAGCCCAGC
AACCACTCACCCGCCCAACAACACAAGCATCACACAGAAAGCCACCGAGTGCCATACTTCCGTTACTTTGGCCCCACTGC
CATAGTTCCGGGCTACAAGCAAATGGTGGTGGACGTGTCGATACGCGATCGCCGTCAGAGCCGTGGCGGCAGCTTTTCGG
TCTCTTCTTCGAACTCCCCTCTTATCGGTGGTGTGCGAAACAATTTCCCAAGCCGACCCGATATGGTATTCGACAGTGTC
GATGAATTGCCCGTCTATGATCCCCACGACTCTGAGCCTGTGCATCCGCTGATCATGACACTGCTCAAAACATTTTTCGT
TCATCTTGGCTGCAATTTTCCATTTCTCAAAGAACGCCGGATCCTGCGAGCAGTGTCCGAAAAACGACTGCAGCCTATCC
TGGTTGATGCCATGTGTGCTCTCGCTGCTCGGGTTTCGGACCCCCTTCTTACCATCACAAATGATGATGGGGAGATTATG
TCGTGTTCCGAATACGGTAATGCGTTTTCCCAGCGCGCCAAGGCTGCCGCTGTAGACACATTTCCGTGCCCTACTATTGG
TGCTGTTCAGGCCTTCATCCTCATGGCATATGAAGGATTCGGCGCTGACCAAGACAGCACTCTCTGGATGTATCTTGGAA
TTGCAATTCGTATGGCAGTCGACCTTGGGCTCCAGAAGATCGTCGGTATTCAGTACCAGACCGGAACTGACCCACTGTAC
ACGAGAGACTCGGCTTTTGAACATGGCAGTGGCAACGAAGGTCACGGCGATACCGACGAAGGAGGTGGTCGACACTTAGC
GACTGAGGATCACACAGACGGCCAAGAAAACGGTTCCTTCAGACTTGAAGAACTGCGCGCCATTGAGCAGGAGCGGGCGG
ACACGTTCTGGACTCTCTTCTTCGCGGACCGGGTCACATCTTCCGGCACCGGTCGGCCGGTGACCTTTCGAGATGACGAC
CTTGAACTTGCCTTCCCAGAGCCAACCTTGGACCCGGCTAGCAATTGGCCAGCACCGTTCCCGACATTGGTCCAGATAAT
ACACATATACGGACGTGTCTCCGACGTGCTCAACAACATTCGCAACGCAGAGGACTTGACCCAAGACAAGATGCGAAAGC
TTGCCGAGATGGAAGCTGACCTGACCCAACTATACCAGAAACAAGATCCACGCCTAAATTTCAACGCGGCCAACTTTCAG
CAGTATGTGCGTGATGGACAGGGAACAAACTTCATTCTTTTGCATTTCTGGTTCCACGCTCTTATTATCATTCTACACCA
ACCAACGCTATTAGCCCCATTCGGTGGCTTTCCACGAGACCACCAGCTGTTGGCCAACAGCCATGTGCTGTCCATGTCAA
GCGCCAAGACAATCGCTGATATTTTGGCTTTTGCTGAATTGATTGATCCAAAGAGCTTCATTGGCAACCCTTTCACTTCC
CAGCCTATGTACATTGCCGCATGCGCTTTTCTGATGGAGTCAGCTGCCAATGTAACATTCCCAGCTTCGCGAGAGTATGT
TTCGCCGTCCGCCGATGATCTGCTGCCCGAAACCGAGCAAAGAGACCGCTCTAGCGGCAGGGATCCTGGTGCTGCAAAGT
TTACGACTTCTTCCAAGCACGCCCTTTTGGCATCCAACGCAAATCAGAACTATCAGCGGTGCTACAAGTCGCTGCAGCAG
ATGCAGACCTACTGGGGTGGCGTACGTTACATCTTGACCGCGCTTGACCAGAAGGCAAAGGGGATCTGGGACTGCGAGAC
TTACACCTCCGAAGAGTATGAGAGCATCAAAACCCCACCTCGCCATTCCGCTCTCCGTGAGCTGGCCACCCTGGAAAATT
CCAATTCGCCAAGCGTTCCTCCGATCGCCTGGTCGCTTACCGGAACTTCCAACTCGTCTAGTCCAAGCTTGACGCTGCTA
TTCCAAAGTCATGCAAACATAAATGGGTTGCCGCATAGTCCTCGAGATCACCGTCAAGAGCTGCAAAAGATGCAGAATGA
CCTTGAAAATGAGCGACAGGGACATTCTCGACATCAGAGCCATCACAGGCATCCCCAACAGCAGCTGCCGCAGCCGCCGC
AACAGCAGCCGCCACATCAGTCGCTACACTCTGTACCGGTTACCTCTTCGCCTGGAAATATGAGATATGATCCTATTCGC
CAGAGTCTACCAGAAATACCTGCCATATTCACGCCTGCGTATTCGCAAGCAACCGAGTCGGCTGTTCGGTACTCTGCCCA
TCCTTCTCCACGGCACAAACATCCCAGGGCGCGATCGTCTCTGCCAAGCCTTTCAGACATGCCAACTACCGCGCAGTACA
AGTTTAGCCAGGGACGCTCGTGTGACTTTCTCGCAGAAAAGTATGGGCAACAGTCGGATGCCCATATCTACGACAGCAAT
GCCCATCACAGACAGCAGGAAAATCATGGCCGTCAGCACTCGCGTGAGGACTCGCACCTTCAAGGCACCTATAACAGCAT
GCAGGGTAGGGAAATGGAACAGCCACAGCTACAATCGTATCGACCTGAACCCGTGACTGCCGGTCCATATACCTCGCCAC
CGTCCCATACTGTGTCCCCGTTTGAACCGCCTGCTCTTTGTGGCACCTCCCCAGCGACGAGCAGTCTTACGGATTCCGGG
CAGAATGCCGGCAATGGGGCATACATGAATCAGGCTACAGATGAGGCGAGACTGTATCGCCAGGATTCCATCGGCGACTG
CTTGGCTGGTAGCTCTTTCCCGTACATCACAGGTGGCGGAAATACAAATATCGTTACCTTCAACAGCCAGGAGATCGACA
TTGGCTCTGTCAGCTTGCCAGATGAAATGCCTCAAGAATGGCTTGCCTACCTTCCAGGAGACATTGCCAATCTTTTTGAC
GGCAATGTGCACGACTTGGTGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62