GenePrediction:GLEAN_7006 Details

Name: GLEAN_7006
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:353958..353293 (- strand)
Length: 666
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:353958..353801 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_108:353512..353373 (- strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_108:353303..353293 (- strand)
Length: 11
>GLEAN_7006 class=GenePrediction position=GCSC_108:353958..353293 (- strand)
ATGGCGGGCAAGTACGTCACGCTTATCTCGGCAGAGGGCTTTGAGTTTGTCGTCTCTCGTGTGGCCACGGACATCAGTCC
GGTGGTCAAGCGCATGCTTGACCCCAAGAGCCAGTTCGCTGAGGCCCAGTCTGGCCGATGCACGTTCCCTGAGATCAGGT
ATGCCCGTTCCCCTGCTGGCTGCGAGAGCGCGTTGCGGCCGTCTGTCGGCTACGGTCTGTGATGATTGCACACAAAGAGG
CTCCCAAGCTTTCGACCGGAACCACTGGCGCGTTCGGTCTTGCATGAGACACGCTGTCCTTTGGGTTCCCCGTGGGAGCA
TTTCCATCTACACTTGATCTGAGATCATCTACACAACCTGTCTCGGCTTGCTCCCTCCCCCGGCCAACAAGACGCTTGCT
TTGCTGACTGTTGTGCGCACGTGACTTTCCCGCCTCCTCACTGCAGTGCCCCCGTACTCGAGAAAGTTGTCGAGTATTTC
CAGTACTGGTACAAAAACCAGAACAAGGAGGACGTGCCGGACATGGAGATTCCAACCGAGCTTTGTCTCGAGCTGCTGAT
GGCTGCGGACTATCTTGGACTGGACAGTATGTTTCTTCCTCGACGACGTTCTTTGTCAGACCGGATCAGCTGACCGTTGC
CTTTTTCTCTCACAGAACTGGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62