GenePrediction:GLEAN_7008 Details

Name: GLEAN_7008
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:346877..342072 (- strand)
Length: 4806
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:346877..346771 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_108:346680..346318 (- strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_108:346259..343881 (- strand)
Length: 2379
Type: CDS
Source: GLEAN
Position: GCSC_108:343803..342072 (- strand)
Length: 1732
>GLEAN_7008 class=GenePrediction position=GCSC_108:346877..342072 (- strand)
ATGCTCGACAAAGACCACGTGACCTTCAGCGCCCCTGCATCTGAGCTGCTGCGGGGGGATCGCCGGATGCCGACGGTGGC
CACTGTAACGCTTGTCGGAGCTGCTCTGTGATTGGAGGCTGCTGCATCACAGTGCGCCTAACTCGCGCTAACAGTTGGTT
GTAAGAAGCTTTCTTATCTGTCGCCTCCGATCTGCAGCACGACGATTGTCTTTCTGATCTTTTCCCCTCTTCTGTGCAAG
AGCGAGAAGAACAACGAGAAGAAGAGCGAAACTCACCAAACGGTCGTCAACGCTCACTGGGACATACAGACAAAGGATAG
TGGCTTGCCAAATACCTGCTGCATTGGGTTTCGATACGCCCAACCGGACACGATGGCTCCCACTGCCGTTTTGCCTGAGC
GCGATGCCGGTGCGGAAGGTTCTTTCTCGAGCCTCACGACCTCGTTTGACGACACGTTGCGGTTCTTTCTCAATGGAACG
CGGGTCGTGCTCGATGACATTGACCCAGAGGTCACACTGCTGGAGTATCTGCGGGGGATTGGGTTGACAGGGACGAAACT
GTGCGTATTCCGGACGTTGCAGACTATCGATATCAACTTTTTGCTGACAGAGCCTTAGTGGCTGTGGCGAGGGCGGTTGT
GGTGCTTGCACTGTCGTTGTGAGCCAGTTCAACCCGACGACCAAGAAGATTTACCATGCTAGCGTCAATGCGTGTTTGGC
ACCGCTGGTGAGCGTCGACGGTAAACATGTGATCACGGTGGAGGGAATCGGCAACGTGAAGTCGCCGCATCCAGTGCAGG
AGCGCATCGCGCGCGGCCACGGCAGCCAGTGCGGCTTTTGTACGCCGGGTATCGTGATGAGCCTGTACGCGCTGCTACGC
AACAACGACCAACCGACGGAGCGTGACGTGGAGGAGGCGTTTGACGGAAATCTGTGTCGATGCACGGGCTACCGGACGAT
TCTGGACGCGGCCAACACCTTCACGGTGGAGGCAGGGGCCAAGGCGGCCAAATCGGCCAAGGCGTCCGTTGGGTGTGGAC
GTGCCGGCGGCTGCTGCATGGAAGCCGGAGGGAAAGGCTGCGGCAACGACAACGATGGTGACGGGACTTCTGCGGGTGTT
TCAACTGCTGCCGTCACGGACACGGCTTCTTCGAGCAGCAGCACGACTGACAGCGGGTCTCCCGAGAGAGGGACGATCTC
GGACAGCGCGTCCAGCGTTTCGACACGCTTTACGCCGCCTGGGCTCATCCCCTACGACCCGGAGACCGAGCTGATCTTCC
CGCCGGCACTGCGACACCACGAGTTTCGACCGCTGGCCTTTGGCAACAAGCGCAAGCGCTGGTTCCGACCGGTGTCGCTG
GCACAGCTACAGGAGATCAAGCGGGCGTTTCCGCAGGCCAAGCTGATTGGTGGCAGCTCGGAGACGCAGATCGAGATCAA
GTTCAAGGCACTGCGCTACCCGGTTTCGGTGTACGTGGGCGACGTCGCAGACCTGCGGCAGTTCAGCTTTGCGGACGAGC
ACGTAGATGTGGGCGGGGCGGTGACGCTGACGGACCTGGAGCACCTCGCAGCTGAGGCGGTGAAGCGGTACGGCAGCCAG
CGCGGGCAGGTGTTTGCGGCGATGCGCAAGCAGCTGCAGGTGTTTGCCGGGCGCCAGATCCGCAACGTGGGCACGCCTGC
GGGCAATCTGGTGACGGCATCGCCGATCTCGGATCTGAACCCGGTGCTGATGGCGGCAGAGGCTGTGATCCAGGCACACA
CGGCCAACGGGACGGAGCCGGTGGACATTCCGATGGCGGACTTCTTTGTGGGCTACCGGCGGACGGCGCTGCCGAGCGAT
GCGGTTCTTGCGTCGATCCGCATCCCGTTGACGGCCGAGCGCGAATACTTCCGGGCGTACAAGCAGGCGAAGCGCAAGGA
TGACGACATTGCGATTGTGACGGCAGCGATGCGGATCCGGCTGGACGAAGATGGCATTGTGGAGCAGTGCCGGCTCGTGT
ACGGCGGCATGGCACCGACAACGGTGGCGGCTAAGGGGGCCAACGACTATCTCGTGGGTCGGCGGCTGGCTGAGCTGGGA
ACGCTGGAGGGCGCAATGGGAGCATTGGGGACAGACTTCGACCTCGCCTTCTCGGTGCCGGGCGGAATGGCATCGTATCG
GCGGGCGCTGGCGTTGAGTCTGTTTTACCGATTCTATCACGAGGTGATGGAGGAAGAGAATGAGAGAGAGGGCAAGATCG
AGCGAAGCGAGGTCAAGAAGGAAAATATCGAGCAAAGTTCGGAAAAGAAGGAAACGGACAGTTCGGCTTTTACGGAAATC
GATCGCGACGTGTCGTTTGGAGCGACGGACAACGACGCGGCGGCCGACTACATTCAGGAGGTGGTGGGCAAGGCGCCGCC
GCACGTTGCAGCACTGAAGCAGACAGTGGGTGTGGCACAGTACACAGACGACATGCCACCGCTGGCAAACGAGCTGCACG
GCTGTCTGGTGCTGTCGCAGCGAGCACATGCACGGGTGGTGTCAGTGGACTACGAGGCCGCGCGGGCTTTGGCAGGCGTG
GTGGAGGTGCTTGACCGACACAGCATGCCGAACGAGGCGGCTAACCACTGGGGACCGCCGCACTTTGACGAAGTCTTCTT
TGCAGAGGATGAAGTGCACACGGTCGGACAGCCGATCGCGATGGTGCTGGCGACGACGGCAGCGAAGGCGGCCGAGGCGG
CGCGGGCGGTGCGTGTGCAGTACGAGGACCTGCCGGCTGTCTTCTCGATCGAGGAGGCCATTGAGCAGAACAGCTTCTTC
GATTTCGCGCGCACGCTGCAACGTGGCGAGGGCGCGATCGAGGATGCCTTTGCAGGCTGTGATCACGTGTTTTTGGGCGA
GTCGCGCATGGGCGGCCAGGAGCACTTTTACCTGGAGACGAACGCGGCGGTGGCGGTGCCGAAGCCAGAGGATGGCGAGA
TGGAACTGTTTTCGAGCACGCAGAACCCAAATGAAACGTGAGTTGTGTGTTATGCAACTATGCAAACATGCATATACACA
TACATCATTTATCGTCCACTACTAACACTCTCAGACAAGTTTTTGCTGCCCGGGTCTGCAACGTCCAAGCTAACAAGATC
AACGTACGGGTCAAGCGGCTCGGCGGCGGGTTCGGCGGCAAGGAGACGCGGGCCCTCCAGCTAAGCTCGATCGTGGCTCT
GGGCGCCCACCTCACGCGGCGACCGGTGCGCTGCATGCTGACGCGCGACGAGGACATGGTGACGTCGGGCCAGCGCCACC
CCTTCCTGGCGCGCTGGAAGGTGGGCATCAACAGCGACGGCCGGTTACAGGCGCTGTCGGTAGACCTGTATAGCAACGGC
GGCTGGACCTGGGACCTCTCGGCAGCCGTGTGCGAGCGGGCGATGACGCACTGCGACAACTGCTACTTTATCCCACACGT
TTCAGTACGTGGCCACATTTGCCGGACGAACACGATGAGCAACACGGCATTCCGCGGCTTCGGCGGGCCGCAGGGTCTAT
TCGTGGCCGAGTGCTACATGTCCGAGGTGGCGGACCGGCTCGGCATCGCAGTGGAAGAACTGCGAGCCCGCAACATGTAT
GCTGTCGGGCAGCTGACGCCGTTCAACCAGGCGCTGACGACAGACTTTCACGTGCCGCTGATGTACAAGCGGCTGCGCGC
CGAGACGGGCTACGACGAGCGGATGGCGGCAGCGGCACAGTTCAACGCCGGACATCGGTGGCGCAAGCGCGGACTGGCTC
TGATTCCGACCAAGTTTGGCATCTCGTTCACGGCCCTGTGGCTGAATCAGGCAGGGGCGCTGGTGCACGTGTACCACGAC
GGGTCGGTGCTGGTGGCCCACGGTGGCACGGAAATGGGCCAGGGGCTGCACACGAAGATGACGATGATCGCAGCACAGGC
GCTGGGCGTATCGCTCGACACTGTTTTCATCAGCGAGACGGCAACGAACACGGTGGCGAACGCGTCGGCCACAGCGGCGT
CAGCATCGTCAGACCTCAACGGCTATGCAGTTCAGAACGCGTGCGAGCAGCTGAACGAGCGGCTGGCGCCATACCGGAAG
AAGCTGGGGGCCTCGGCCGGACTGCGCGAGCTGGCCCATGCAGCCTATGCAGACCGGGTCAACCTGTCGGCACAGGGCTT
CTACAAGACACCCGAGATCGGCTACAGCTGGGAGCACAACAGCGGCAAGATGTACTTTTACTTCACGCAGGGTGTGGCTG
CGGCCGAGGTCGAGGTCGACACGCTGACGGGTGCCTGGACCTGTCTGCGTGCCGACGTGCTGATGGATGTGGGCCAGTCG
ATCAACCCGGCCATCGACTACGGCCAGATCCAAGGCGCCTTTGTGCAGGGCATGGGCCTGTTTACGATGGAGGAGAGCCT
GTGGCTGCGCGGTGGCCCCAACGGTCCCGGACATCCGTTCACGCGTGGCCCTGGTGCCTACAAGATCCCCGGATTCCGCG
ATGTGCCCCAGGAGTTCAACGTGCAGCTGCTTCGCGGCGTCGAATGGGCCGAGCTGCGCACCATCCAGCGCAGCCGCGGC
GTCGGCGAGCCGCCGCTGTTCATGGGCAGCAGCGTCTTCTTTGCGCTGCGCGACGCCCTCAAGGCAGCGCGCGCCGAGTA
TGGCGTCGTGGCCCGCGTGGGCGACAACGACGACGTTGGCGGCCTGCTGCAGCTCGAGAGCCCAGCCACGGCTGAACGCA
TCCGGCTGGCGTGCGTGGACCCAATCATGCAGCAGGCGCGGGTAGAGGCGAAGGCAGGCGAGAAGGACTTCTTCATCAAG
ATTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62