GenePrediction:GLEAN_7009 Details

Name: GLEAN_7009
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:341057..338276 (- strand)
Length: 2782
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:341057..340817 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_108:340470..340448 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_108:339929..339602 (- strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_108:339372..338276 (- strand)
Length: 1097
>GLEAN_7009 class=GenePrediction position=GCSC_108:341057..338276 (- strand)
ATGGAGGACAAGGCCCCCCGCATCGCTCCGGCTACGGAAGGCCACCAGAGCAACGGCCACGGCCATACTCACAGCCACAG
TCACAGCCACAGCCACAGTCACAGCCACAGCCACAGTCACGGACACGGCAGCACCGGCTTCGGCAAGCACAAGACGGCGG
CCAGCGTGGCCGCTTCCGACACCAACGTCAGCGATGTCACGCGCTCGGGCACGCCAAAGAAGCGTCGCAAGGTGAACCAC
GGTATGTCCAGGTGTTGGGTGTGTGTGTGTGTGGTTGCTGTCTGTGATAAGTCTTGTTTTGCATATTTGTCGTTTTCTCT
CCTCTCTCTCTCCTCTCCCCTCCCTTTCTCTCCCCTTCTCACCATGCTCGTGCCGATTTGTACAATGTTGTAAAGTGGTG
CGCTGTACTGCCTGCTGTGCTGTGCTGCAGCTGCAGGTCGGGTGTCACGCCGTCTGCCGTCGTGCCAACATCCGCACTAA
CAATCCTCTGCTGGCCCTGTTTCTTTCTTGTTCTCTTTTCCAGACGCACCTTTCCGCTACTCTCTGATTGTTTCATTCAT
GTCTCAAGTGCTGACATACATCTACAGCTTGCGTGTACTGTCGTCGATCTGTAAGTCTGTTTTTAAGCCCTGTTCCGTCA
GGTCGCATCGGGTACTCTGCTGTCTCGTGGCTTGCATCGTACCCGCCATGTAGACAGACACTTGTGTCACAGCATGCTTC
CTCCTTCCTACCCCTGGTCGGCTGTGTCCTGGTTGCGCTCCGACCAGGCAGGCATGGCCGTATCTGCTGCACGAGGAAAT
GCAGAGACTCTTGGCTGTCCTGGATCACTTTACCCTCTCTCGGACCATGGCTAACCTCGATTTTTGCTGCACAGCACATG
ACATGCGATCTTGTACGTACAAATGCAGATGCTCTTTGTATTTTTTTTTTTTTTCACATCTTCACACGCCCTGTTTTTCA
ACCCCCTCCCTTGTCCTCCCACACCCGCCACCCCCTCTCGCTCTGTCCTGTACGCTCAAGCCACGGCGTATTCTACATGC
CCATTCCTTTCCCCTCTCGCCTTCCCTGCCCCTTCCCGCCTTTCCATCCCCCCCCCCCTTGACCTCAGCCCATTACTGAC
TTCTCCAGGAACGGCCTTGCACCCGATGTGTTAAGCGCAATATCGGCCATCTCTGCCATGACGAACCCAGGGACTCGGAT
TCCCGCAAGTCCAAGAGTGTCGTCGGCACCTCTGTGGCCGACGAGTCTGAAGACTTTAACGCCCACCGACGCGCCTCTAC
CGACCAGAAGACGAATGTGAACGCCATGCCGCCGCCGTCCCTCGATGCCGGCAGCGCTAGAGACGCAGCCAAACCAGCCT
TCAACGCACCTGTGCTAGGTCTGGCCAACCCAATGCAGCTTGTGCGACCAGGCGTGGTCTCTGGAATGCAACCCAATCTC
AGTGACGTGAGCCAGTGTAGGTCCTCTGCCCTTCTTCCCGCCGTCGTGTCCCTCCTCCCCCCCTTTATGACTGTCACTCG
AGTCCCACGCAATCGCCAATATTTCTCAACCCCCTTTCCTGCTTGCACAATTTCAACGCAACGAACACCTTCACATTCTC
AACCAGTCTCGCAATCATTCCTCTTTCTACTTATGGGGAGTCTCACGTCCAGGGCCTTTGCCAGCGTATCTAATTTCTCT
CCCAGTCGGCGGCTTCTCGGATGCCTGGCTGACGGCCCAGAACCACTTCGACATGCACAACCACAACGGCTACATGATCG
TCCCCGAGGTCAGCGGCGAGTTGCAGTTCCTCAACGACTTCCTGCACAGCAGCATGGTCGATGACGCCGCCTTTGTCGAC
GACCAGAACGCCCAGCTGCTGAGAAGCGCTCCGCCAGACGTGGCCACCAGCTTTCTCACCAGCCCGACGACCAACGACGG
CACCAAGAGCGGTGGTGGAGGCGACAGCCGTGAGCTGGACAGCAACGGCAACAATGTTGATAACAACTCCCTGATACCCC
CTGGGACCATGCTCCCACCGAGCGTGCTCGACAGCGCGATGGGCAACAGCAACAATGCTGGCAACGGGCCACGCACACCG
CTACGTGGAGCTGCTGCCGTTGCCGCTGCCGCTGCTGCTGCTGTTGCTAATAACAGCAACGGTAGCATTAACAGTGCTGA
CAAGACGCGCGACTACTACCTGACGGCGGCCGACCCGTCCGGCAACGACACGCCCGAACAGCGCATGTCGGACTTGCTCA
AGGCCAAGTATGAGGCCGGGCTGTTGAAGCCGTTCAACTACGTCAACGGCTACGCCCGGCTGCGTGCCTACCTCGACAGC
CACCAGATCACGCTCGGCTCCAAGCAGAAGATCCAGCGCCAGCTCGACCGCTTCCGGCCAAAGTTCCGCGAGAAGATGCA
GGCTCTGACCGACCTCGAGCTGATCTATGTCGAGATGTGGTTCGACAAGACCCTGATGGAGTACGACCGCGTCTTTGCCA
GCATGGCCGTGCCGGCCTGCTGCTGGCGCCGCACCGGCGAGATCTTCCGCGGCAACAAGGAGATGGCTGAGCTGATCCAC
GTGCCGGTCGAGAAGCTACGCGACGGCAAGATCGCCATCCACGAGATCCTCACCGAAGAGTCCGTCGTCCGCTACTGGGA
GGAGTTTGGCACCATCGCCTTTGACACCCAGCACGACACCCTGCTGACGGCCTGCTCCATCAAGAGCCTCGATCAGGGCG
GTGGCGGCGTCATCAAGTGCTGCTTCTCGCTCAAGATTCGCCGCGACGAACACAAGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62