GenePrediction:GLEAN_700 Details

Name: GLEAN_700
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1520720..1522741 (+ strand)
Length: 2022
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1520720..1521905 (+ strand)
Length: 1186
Type: CDS
Source: GLEAN
Position: GCSC_97:1521963..1522741 (+ strand)
Length: 779
>GLEAN_700 class=GenePrediction position=GCSC_97:1520720..1522741 (+ strand)
ATGGGGTCGAAAGCAGGCCCCCTCCTAGACGCGGCTCGGGCAAGCCAGAATCCCCAGCGCGGCTCGGCGGACGTGCCTGC
CCTGAAAATCGAATATGACGACGAAGCAGGAAACAACGGCAGTCACAACCGGTCGCAACCAGCATCGATGACGCCGCTGA
CTCAGCAGACGCAGCCCCCCTCCCCTCTCTATTCACTGTCGCCTGGGGTCGATGCACATGCAGACACAGATCTAAATCTA
GCTTCGTTTGCGGCAAACTCCTTCCTACCTGACGACGATGTTCCGATGACGGATGCAACCGACTCGACAACTACCGCCAC
AGCAACGACAGCGACAGAAAGGCCGCCCTTCAAGCCAGATCCCTCACCATCTGCTACGACTACTCCAGCAAAAAAGCCCA
GGATGGGAGGAGCGAGGAGTCGTGGCGGCGGCGCATCCAGGAGACGTGGTGGTAGCAGTGCTAGCCGCGGTGGTGGCCGC
AGCAGGGGAGGGGGCCGGGGCGGTGGAAGCAACGGACTGAAATCCGGCGGAAGAGGTGGCAGCAGAAAGTTATCAGCGCT
CTCCAATGGGGGGAACTTGAAGACTGGTGGATCTCCTGCACCTGGCATCAAGCGGGAGGCGGGCACTACCCCTTCCCTTG
CCTCGGACGACGACCAGCAAGGTGGCAGTGAGGAGGAGGAAGGAGAAGACGACGACGATTCGTCCGACAACGGGCCGTAT
TGCATCTGCCGCGGGCCTGATGACCACCGCTGGATGATCCAATGCGACCAGTGTGAGGACTGGTTCCACGGTGACTGCGT
CAAGATCGACAAGGAGCTCGGCGAGAGCGTGATCCTGAGCTACATCTGTCCCGCCTGTGCCATACCCGAACGCTATATCA
CCCGCTTCCGCAAGCTCTGTTCGTTTCCGTCTTGTCGACGGCCTGCCCGTCTGTATGCCGAGGACAACGTGTCACCAGCG
TCACCGGACGTGGCCAGCTACTTCTGCTCCGACGGACACCGGGACCAGTGGTGGGATGCTCTCTTGGCGCGCATCGACCA
GCGGAAAGAAGGCAGCGGTGCCATCCCCGAGGACAAGATGCCCATCGACCAGCTCACGTCAGTGCAGCTGGTCTCCGTCC
TCGCGAGCAGCAACCAGGAGGGCGTCGCGCAGATGTTACTGCATGGCCTGACACAGGACAAGAATGGTACGTTCCCTTCA
TTTTCTGGCTGTGGAGCCAGTCCACGTTTTCTAACTCCCACAGTCGACCCTGAGTCGCTGCTCACCGGCGAGGAGCGCGC
AGTGACGCAAACGTCCACTGCGCAGCGTCGCCGCCTCGCTGAGCAGTACGGCATGTGCAAGAAGATGTTGGAGCTGCTCG
ATATGGCCAAGTTCCGCAATTACGAAGCCATCAAGGCCGGTCTGATCGAGCGTGATTGCTGCGGATACGACGACCGCCTG
GAGCATGTCGGAGTGCAGCCGCACTTTGAGCAGTTTCTGGCCAGCCCAGAGGGCGCTGCCATCTTCCAAGCCGGCCGGCT
AACAGCCCCATTGGCACACCCCGGCGAGAATGACGACGGAGATGGCGCCAGCGACAGCCCTGCGGGTTACGAGGCGGCCA
CGGCTGGCATGTGCCGGAAACGCAAGTGCAAGGCTCACTTGGGCTGGTTCCCGACGCTGGCACGGGACGTGCGCATGCAG
ATTCAGGACTTGACGCGTGAGGCGGCTGCACAGCGGGATATTGAAACGCGCATCCGGTGCGCGGCTATGCAGCGGGCGTT
TGTCAAACGACACATGCGGTCCGAGGTGCTCTTTGTGGGCGACTCGGACAACTCGCTCTCGTCGTTGGGCGGCGACAGTG
ATAAGTCGGACAGCGAGGCGACCGATGAAGACGACAACAAGCCGGCAAAGCAGCCGGACGAGTCGTCATCAGCGTCGCCA
CCCTTTGACGGATACGTCGGATCGTATCGGAGCAGTGTCGAGGAGAGTGCCCCTCCACGCAACGACTCCAGCCCGGGGAG
TATTGGCGCATACAGCGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62