GenePrediction:GLEAN_7010 Details

Name: GLEAN_7010
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:335162..331845 (- strand)
Length: 3318
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:335162..334739 (- strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_108:334194..333920 (- strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_108:332099..331845 (- strand)
Length: 255
>GLEAN_7010 class=GenePrediction position=GCSC_108:335162..331845 (- strand)
ATGAGACTTCTTGCGCATGGCACTGATATTACCATAGATGAAATCGGAGAACTTGAGCGTCGCCTTCCCTATCTCCGCAC
CGACGAGATCGCAGCGGCCGCCCTGGCCGACGATCTTCGGAGGCGTATTCTTGGCGGTTCTGTCGGCAGCGCCACTGCAG
CGACAGAAAACAGTGTCATTTCCGACTCTCTTGTCCTCAAAGCTGGCACCAAGCTCTGGAATTTGGTCCTGAGCCTTGGA
AGATATGTTGCCGGGAACGCGTCACCGGCCTACAAGCGGCTGCTTCTGCATGGCCGTGCATTTGCTTTCCTGGCCGTGCA
TTCGGCCGGGTGGAAAATCCACACAAAGCCAAACGCAGGCCCGCCATTGAAACGAGTGCTGTGGCTTCTGGAAATGTGTT
CCCACGCGGCTAGTGGATCCATCCGTACGTGAAACTGGGTTGAGGTCATGCCACGATCGGCAGCTGACAGTGCCAGGAGA
GAGAGACACCGAGCTTGGAAGTATTGCTCTCGGCAAGGCTTCGACGTACAGGGAAAATATCCTGTTGCAGCTCGGCCGCT
ATCCAGTCAATGAGGATACGGACAGAATTAAGGAAAAGTATCGTCTGCTGCAGGCTCAGATAATTGTCTCCAGAACAGTA
CAGGTAAGGAGCTTGACTGGGGCGCTTTCCCTTATTGCAGTAACTGACATTGGACAGCTCTGGCTGGAACACAAACCAGA
AGCTGCAGAAATGGCGTACGACCATGAATGGATTTTGTCCGTTATAGAGCCTCAGTATTCCGATTCTGCAGAGATATTTG
TTTCCTTTCTTCATGACATTGGTAAAACTTTGATGGAAAAACGGGAATATTTGGCATCCATCGTATGGTTCGATCGCAGT
CTTGAAATTGTTGGCCGCCTTCGCCAGATTTCTCAGATCTCGGACAGTATGAAAAAGTGCCAAAACAATGTGACATATGC
ACTCGCAGTGGCCTCAATCGGATTGTGTACACCCCACGGACGCAAGAGGGCACAGGAGCTTGTTGAGGATATAGAGGCAC
AGCTTGGCCCAAACTGTCTGTGCGTGAACATTGTCAGCCTGGAGCTTATTGCTGCATCAACATCAGAAGACTTCGATGCG
CCTCGATATTCAAAGGTGCTGTTAAATATGATTGAAAATTTCGATGGGTCGAGCAAAGAGTTCCGGCACCTTCGCCATTA
CATCCAACAACTGCACAACAAGAGCCCAGGCCTTGGCTGCGAAGTACTGGACAGTTTTTTGTTGGCTTTACGCGAATCGA
ATTCGACGGAATGGATCGAAAGTCTCGTGATCATACGTGTGTGGTTACTGGTTCAGCAAAGAGAAGCACAGGAAGGAATT
GATGCTGCTGAGCGTGTCCTGTCGAAGTTGAGGACATCTATCAGTGCAGACACAACCGCGGCAGCCCAAACAGTGAGCAG
TCACGGTGGTGTTTGAATCTCCACAAACAATACTCAATGCTGACGTACAGTACCAGTTGATGTGGAAAAAGATCGAGCAA
GGCTACCAAGAAAAGCAGTATGCTACAGCTATCCGGTGGTGCCGCCTCTCGATGTGCCACATATTTGAAGCTGGCGGCCG
AACCAACAGAGCTCTGGTTGAAAGGTAGGCTATGTAAACGTGGCGAGAGAGATACTCTAATTGCCGCTAACTGTTTTCAG
GAGACTTCTTTCGTGCTCCATCGAAAGTGGTGATCTGGAAACAGCACGGGCAACATACGAATCTATGCCAGAATCAACAC
GAGATGACACTATGACGCAGTATCTGCTTTTCAAGCTTTCCGTCCGACTGGACGATATGGAGATGGCAATGAAGTGCCTC
AAACACATTAGCTTATCCGCCGATGGAAGAGAGTTTCTCTATGCCTGCGTTCTCTATGCCAAAAAGTCTAAGGCCCTTTA
TTTCACCGTGCAGGCCTTGAAGAAACTGGCTGATACAGCTGACTATAACAGTCAAAGTCCTCTCCACACGCCTGCTTTAT
TTCGTTGTACAATTTTGATGCTTGAGGACATAATCAAAGAAAGCGTCGCAGACACGGAAGATGTAAGCGGCATCGTGGAA
TCTGCATCTCGTGACCTGGCGACCGTTTTTGAAGGAGGTAAACAACATAATGATTTCCTCTTCCCTACCGTGCATCAACT
AATGTTATTTCAGTGGTCGAAGCTATCGAGGCTAGCTATAACGCCAACGTAAATACGGCGACGAGAGCATTCAGCACAGA
TGAACTGGTTTGGTTCTGCAGGGCCTCATACAACCAGAGTCTCAAGTATTCCAGATGCTTAGATCTTCGCAGCATTGCAA
GAATTCTCATATCGTGGAGGAAAATCATCAAACTGCTTCCCGAAAATGTGGAATCCCAAGCCTCAACGGACGTGGCATCG
AAGACGCTGAACTGTCACTTCTTGGTTGCATCAGCTCTGTCGGCACTGGCAAGAGAGCCGGAAGTTCCAATTCAAGAGGA
ACAGGTCATCAAAGACTACCGTGTCATGCGTGAGAATATTATGGCCTTTCAGGTGCAGTTGAGGCAGTCTGCAAATACCA
GTAATACGTCAGAAACATATTTACACTACTCTAGTAAGCTACCTGCTCTCTTTGTGTTCGACTTTGAGGGGGCGATCGGT
CTTGGAGACTGGGACGAGCTTAATGGAATTTGTGAGAAGGCAGCCGCTTGCAACAACCCTGATACATTTCGCGTCCTGGG
TGACATTCTGTTACAGTCACAAGCACGAGTGCCTACCCAAAGTCAGCTCTCCCCCACGTCATGTATTCATATACCGTTAC
TGACCCGCGGCAAACAGACTTTCTGTCAACCTTGCGTTTCTTAATCGATAAAATTCGCCAGGTCGGCGGATTCGACTACG
AAAAGCTCGTCAAATATTATCGCTGCCTATTTCAGGGTGCGCTCTACCGAGACAATGATGTTGCTTTCCGGATCTTGGAG
GAGATTTTTGAGACATTGCAGAATGCTACTGTTGGAATGGTAATGAATCCGGCAAGCATCCGTTTTTGAGTGCACACAGC
TGACAACGGCTCCCGAGACGTAGGATCAAAGCTGGCCAGAAGACGATATACAGTACTTGGCCATCAAGGCATTCAACGAG
GGTATAAGCTGGTTCGCTCAGAGACAAGAAGGCCGCGTAAGGCAGTGGACTCTCTTGGCGGACAGGCTGAGCGATCGATG
TCGCGACGGAGGCAGACTCAAAGAAACGATTAGACGCAACTTCTCACTTCTAAATATCGGTGACCTAGAGCTAAGACCCT
CCATCGAGGAGGATGAGGATGCAACGAAAGAGACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62