GenePrediction:GLEAN_7012 Details

Name: GLEAN_7012
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:328695..325122 (- strand)
Length: 3574
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:328695..328639 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_108:328579..327780 (- strand)
Length: 800
Type: CDS
Source: GLEAN
Position: GCSC_108:327722..326085 (- strand)
Length: 1638
Type: CDS
Source: GLEAN
Position: GCSC_108:326034..325122 (- strand)
Length: 913
>GLEAN_7012 class=GenePrediction position=GCSC_108:328695..325122 (- strand)
ATGGACCCCAACGAAGAACAGCCACCGCCGGAGCCAACTCTGCCCAGCCAGGAGCAGGTATGTCGGATGATGGAGCTTGG
TGGGCCGGGCAGCTGACCATGTTCGTTCTCCTGCAGATGCGGGCACGGCGTCTTGCCAAGCTGGGCGCGACCACGCCGTC
CTCCACACCGAAAGACACAGACAGAGCCGGCGACAGCACAGTCCCGACAGCGTCGACGTCGTCGACCTCTCCCTCCACAT
CCACGCGACAACCGGCCACCGCATCAGCGGGAACAGGTAATGATGACCACGTCTGCCTTGCAGCTCTGCAGGGAGACCAC
AGCCACCCCACAAAAAGGTCGCTTGCCGACGTTGATCCAGCTGCAGCGAGCCCCTCTGGCGCCCCAACTGACCCGCCGGC
ACGGCGGCCGGGTGCCGCAACCGCGTCCACAACCCCAGCGACAACCCCAGCGACCTCGAAACCGGCTACGGCAGCCGTTC
CGACACCGACTCCCGCCACCCTCTCCCCTGCCGACGCCCTGGCCGAGTGGACCGATCACGTCATATCCAGCACGCTCCGC
GTGACCATCGAGTCGAGTCGGACGCGCGACCGCCACGGCCACCAGGTCGCGTTCCTGCCAGGCCTGCGGAGCGAGATCCT
CGAGCGCAATGGCGAGACCGAGAGCGACAAGGCCGAATCATCCAAGAAACCGCTGCGCCTCACCATCGATGACATCGATC
CGGCCATCCTCGAGGCGTCGACGGAGATCAACCACAAGCGGCCGCTGCTCGACTACCTGCTGCCGTGCTACAAGGCGGCC
AGCCGGCTGCTCAAGACCCGCGTCACGAGCACGGAGCGGCTTGCCGTGCTGCACGAGCTCAAACGACTCTGCATGTGCAA
CATCGTCTTCGCCTTGACAATGCCGGATTACTTTGGGTAGGAGCTTGCTGCATCGTGTGACGTATTTGGGTTATGCTTAT
ATAATCGTGTTAGCCGGGAACCAAATCGGGAGCACGACACAATCGTGCCGTATCTGCTGCGCGGCGTGCGGCCGGACGAC
GTGCTGAGCCTGGACATGGACTTCATCACGGATGCGGTGGCGCGGTTCGACGACGACGATGACGGGCAGGTACAGGAGAT
CTTCACGCGAGCGATGGTAGAGATCAGCTCGAAGCTGGCGACGATGACGATGAACGACGAGTATCTGCCCTACATTGAGG
TGCTGCTGACATACTCGCGGTTCAAGCCGCTGCTGGTAGCACTGGCACGACACCCGTCCTTCCAGATGGCACAGTCGGCG
CCCAACATTGAGCGGTTCACGCTGCTGGGCCCGTTCTTCCGCATCTCGCCGCTGCAGCACGAAGTGTCGACGGCGTACTT
TGGCGGGCACCACAAGGTGGAGATGCCGCGCAAGGAGACGGTGTACAGCGCTCTGCAGATGACGGTCAATACGCACCAGG
CGAACCTGCACTCGATCGCGATGGCGTTTGCACGGGCGGGCGACGGGCCGCGGAACCGACTGCTGGACTGGTTTGCGTAC
GCGATGAACATGAACCACAAGCGGCGGGCGATGCAGGTCAGTAGCAAGGAGGTGGCCTCGGACGGCTTCATGATGAACGT
GGCAGCGGTGCTGGACCGGATGTGCGAGCCGTTCATGGAGGCCAACTTCTTGCGGATGGAGCGGATCGACATCGACTACC
TGCGGCGCAAGCCGCGGATCAACATCACGGACGAGACGAAGCTGAACGCGGACCAGGCACAATCAGATGCGTTCTACGGG
AAGCCGGCGGGCGGAGAGAATAAGTTTGTCAGCGAGCTGTTCTTCCTCAACATGGCGTCGCACCACTACGGCAGCGGGGC
AGCGGGTCAGCGGTACAAGGACATTGACCGGGAAATCAAGCACATGGAGGGCCAGCTGGCGATGCTGGAGGAAGAGCGCA
AGAAACTGCTGGCGACGGCGGCAGCAAACCCGCGGGCGATGGTGCTGGTGGAACAGCATCTCAAGACGTACACGGCGGCA
ATCGACCGACATGTGTCGTACAAGTACGCGCTGGAGGCAGTGCTGTCGGACGAGAAGATGCAGGTGCGGTCGCTGATGTT
CATGCGGTACGTGTCGGTGTGGCTGCTGCGGGTAGCCAGCCGATCGGACTACACGCCGGACAAGGAGTTGCAGCTGCCGC
TGCCAGGCGACGAGCCAGAGGCATTCAGCTGCCTGCCGGAATATGCGCTGCAGAACGTGGTGGACCACTTCAAGTTCCTG
TTCCGGCGAGTGCCACGGATCCTGCCGTCGGCCGTGGGCGATGAGATGGTGGCGCTGTGCATCACCTTCCTGGAGTCGTC
CGATTACATCCGCAACCCGTACCTCAAGTCGTCGCTGGTGTCGCTGCTGTACTCGGGAACGTGGCGGATGTACCACCTGA
CCAACGGAGTGCTGGGCGACGCACTGGCCAACAGCAAGCTTGCGAACCGCCACCTGTTGCACGCGTTGATGAAGTTCTAT
ATCGAGTGTGAGTCCACGGGTGCACACACGCAGTTCTACGACAAGTTCAACATCCGCTACGAGATCTTCCAGGTGATCAA
GGCCGTGTGGCCAAACGACCTGTACAAGCAGCAGCTGACACAGCAGAGCCGGTGAGTTGGGGGATGTGAGCGGGTGCGAG
CAGACGTTGCTAACATAGCAGGACAAACCGGTCTTTCTTTGTGCGGTTCGTCAACATGCTGCTCAACGACGCCACCTACG
TGCTGGACGAGGCGCTGTCCAAGTTTCCCAAGATCCACGACCTGCAGAAGGAGCTGCAGGAGGGCGGCAGCCAGCTGACT
CCGGAGGTGCGGCAGCAGAAGGAAACAGAGCTGCAGCAGGCCGAGAGCCAGGCGCAGTCGTACATGCAGCTGGCCAACGA
GACGGTGGCGATGATGAAGCTGTTTACGGAGGCGTTGAGCGACGCGTTTACGATGCCGGAGATCGTGTCACGGCTGGCCG
GCATGCTGGACTACAACCTGGTCACGCTGGCCGGACCGGCGTCGCGCAACCTCAAGGTGGACAACGCGGAGAAGTACTTT
TTCAACCCCAAGGTGCTGCTGCCGCAGCTGGTGGAGCTGTATCTCAATCTGGGCGACAAGCAGTCGTTTGTCGACGCCGT
CGCCGCCGACGGCCGCTCCTACAAGCCCGACATCTTTTCCAACGCGACGCGCATCCTCGCGACCAAGGGCCTGATGGACC
CGGCCAAGCTGCAGGCCTGGGATGCGCTGATGGCCCGCTTTGCCTCCACCAAGGAGCTGGCCGACCAGGCCGAGACTGAT
CTCGGCGAGATCCCGGCCGAGTTTGAGGACCCCATCATGGGCGATCTGATGCGCGATCCCGTCATCCTGCCCTCGCGCCA
CACCGTCGACCGCTCCACCATCACGCAGCACCTGCTGTCCGACCCCAAGGACCCGTTCACGCGGCAGCCCATGACCATGG
ATGATGTCGTGCCGGATGTCGCGCTCAAGCAGCAGATTGACGACTGGAAGGCCGGCCGGATCGCGGCCGCACGGGCGAAG
CTCGAGGGGACCGGCGGGGCGGCCGGCGAGGCCATGGACACGCGTGAGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62