GenePrediction:GLEAN_7013 Details

Name: GLEAN_7013
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:316478..315480 (- strand)
Length: 999
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:316478..316212 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_108:316141..315674 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_108:315617..315480 (- strand)
Length: 138
>GLEAN_7013 class=GenePrediction position=GCSC_108:316478..315480 (- strand)
ATGGTTCAGCGGATTTCCCGAGCAACCGGCTTGCAGGCCTTTATCAATGCTATCGAGAAGGATGGTTGTGTCGTGATCCA
GGACTTTACTGATCTGGAGTCGCTTGCGACATCGGTCCGAGAAATCCAGCCGTATCTCGACGCATCAGCCGCAGAAGCTG
CCAAGAGCACTGTGGGTGCCCTGAACGGCGGAACGGCCATCTGCACGCGCCTGATCGGCCGGAGCAAGACCGTTCGCGAA
AAGTTCTTTGCGGACCCCCTGTACCAGGTACCCGCAGTCTGACGTTTCGAAAGCCTCCGATCCAAACGGAACCACTCGGC
TCACCGTTGCTGTGCAGGCGCTTGCCGACCACATCCTTGGCCTGGAGACGACCGTCTGGATGGGAGGCGAGCCGGCTGTC
CATAGGTCAGACCCGCTTCTGTCCATCTCAATTGCCATGTCTTCGCAGCCGGGCTCGAGTCCACAGCTGCTTCACCGCGA
CGACAAGAACCATCACGCCCGGCACACAGCGGCCAGCAAGTACACGCACGGCCGCGACATGCTCCTCGGCCTCTTCGTGC
CTACCTGCGACACCTTCCAGGCCAACGGGGCCACGCGCATTGTGCCGGGCTCACACCTCTGGGGCGACGACCAGCCCGAC
TTTGGACCGAGCGGCGACGTCGGCGTAGAGGATGCAGAGCTAAAGCGCGGCGAGGCGTTTGTCATGCTGGGGAGCCTCTA
CCACGGCGCCGGAAAATATACCATGTCGACCGGGTGTCGGACGGTGCACATCATGTTCATGTGCAGTGGCGTCTATCGCC
AGGAGGTAAGCACGCTCTGCTCTACGGACAGTCAATAGCCACAGTGCTGACGTGCAGGAAGGAAATCCCGTTCCTCAGTT
ACCCAATCGAGGACGTCATGACCTACTCCAAGCTTGTGCAAGATCGGCTAGGCTGGAAACAGTCGGAGCCAAACCTGGGA
TGGGTTGACCTGAAGTCTCCCGAATTTCTGCTGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62