GenePrediction:GLEAN_7014 Details

Name: GLEAN_7014
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:314495..312908 (- strand)
Length: 1588
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:314495..313413 (- strand)
Length: 1083
Type: CDS
Source: GLEAN
Position: GCSC_108:313354..312908 (- strand)
Length: 447
>GLEAN_7014 class=GenePrediction position=GCSC_108:314495..312908 (- strand)
ATGGCCGAAGCAGACGAAGCCGCAAAGGCTGTTTTTCGCCACGAGTCTTTTTGCGACGATGTGAAGCCCTCTGCGACTGC
AGCCACAGCTGCTGTCTGCCCTATCTTTAGCATGGCAGACAACCCGGCCGTGCACATGGACCCGGCGCACCGGGCGGCCG
TGGAGAAGCGGCTGAAGCGCAAGCTGGATGCCCGGTGCAGCCTCTTCGTGCTGATCTACATCATGAACTATCTTGACCGC
AACAACATCTCGGCCGCGCGGTTGAAGGGCCTGCAGAAGGACCTGCACATTGACGACACGCAGTTTGCGACCTGTCTCAG
CATCGTCTACGTCGCCTACATCCTGATGCAGATCCCGTCCAACGTGATGATCAACCGGGTCTCGCGGCCGTCTGTGTACA
TTGGCGTCGCCGTCCTGCTCTGGGGCATGATCTCGACCCTTTCGGGCAACGTCCACAGTTTCGGCGGCATGGTGGCCGTC
CGCTTCTGCCTCGGCTTCGTCGAGGCCGCCTTCCTGCCGGGCGCCCTGATGATCCTGTCGCGGTGGTACACCAGGCGGGA
GCTGACCTACCGCAACGCCATCCTCTTCTGCGGCAACCTCATCTCCAACGCGTTCTCCTCCCTGCTCGCGGCCGCCATCC
TGTCCAACATGGACGGCGTCCTCGGCCACGCCGGCTGGCGATGGATGTTCTGGATTGAGGGCGCCATTACTATGCTGATC
GCCATCCTGGCCGCCTTCATTTTGCCAGACCTGCCGCACAACTCGCGCGGCTTCACGGTCGAGGAGCTGCAGGTGGCCCA
GCTTCGCATGGCCGAGGACGTTGGCGAGGCCGACATCGACTCCGAGGAGATGGGCGTCCTGGACGGTCTCTTCCTTGCCG
TCCGGGACTGGAAGATCTACGTCATGCTCATCTTCTTCATCGCCTACATCATCGGCCTCTCCTTCAACGCCTTCTTCCCT
ACCCTGACCGGTACTCTCGGCTTCGCCACCACGCCCACGCTGCTGATGAGCGCCCCGCCGTGGGTCGCCGCCTGCATCGT
CTCTCTGCTCGTCTCGCTGCACGCGGACAGGACCCAGGAGAGAGTAGGTCCCCGTCTTCATCCCGACACCCTTGTCCCAT
TTTGCTGACAATTCCCACTAGTTTTGGCATGTCGTCGGCCCCATCTGCGGCGGTCTTGTCGGCTTTGTCATCAGCATGTC
CACACTCAATACGGCTGCCCGCTACGTCGCGCTCTTCCTGCAGACGTCCTCGTATGCTGGCTACGTCGTGACCTACAGCT
GGCTGATCAGCTCGTTCCCGCGTCCGCCTGCCAAGCGCGCCGTGGCCATCGCCATCATCAACGGCTTCGGCCAGCTCGGT
AACGTGGCCGGCTCGTACGTCTGGAACCTGCGAGACGACGGCTATCGCAAGAGCTACGGCATCGTCACCGCCATGTTCGG
CGTCACCATTTGCGGCTGCATCGTCTTCCGCTCGATCCTGGCCCGCCAGAACAGAGAGCTAGAGCGCCAGGAGCAGCTGG
ATTCTTCGGCCGACCCGCGTCTGGTGACGGGAGAGACTGTCAGCAAAGGATTCCGCTTCTTGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62