GenePrediction:GLEAN_7015 Details

Name: GLEAN_7015
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:309619..307941 (- strand)
Length: 1679
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:309619..309367 (- strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_108:309313..309177 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_108:309116..308995 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_108:308908..308838 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_108:308772..308294 (- strand)
Length: 479
Type: CDS
Source: GLEAN
Position: GCSC_108:308219..307941 (- strand)
Length: 279
>GLEAN_7015 class=GenePrediction position=GCSC_108:309619..307941 (- strand)
ATGGCAGTCTCCCAAGCAGCATATGCAGTCGAAAAGGCGATTGGCCACGATGGTAGCGCCGTGATACAGCAAGACATCAC
GAACTATGCAGGTCACGGTGACGGTAACCAGCGGATGAAGGCCTTGGTGTGGCAGGGGAAGAACAAGGTTGAAGTGGTTG
AAGTTCCCAAACCCAAGATTATTGAAGATGGAGATGTGATTCTGAAGGTGACAGGCACTACGGTCTGTGGAAGCGACCTG
CATCTGCTCCATGGTGAGTTCAAGCTCACACAACCGGTTCGACTGATTCGAAGCTGACAGATGAAGGTACTGTTGTGCAA
CTGCAGAAGGGGGATATTCTCGGGCATGAGTTCTGTGGCATTGTGGAATCCGTGGGCCCCGCTGTCAAGAATATCGACGT
TGGCGGAAGATATGTGGCTTCTTTTCAGATTGCCTGTGGTGACGTCAGTACATGAAGATGTTGTGTTTTCTCTTCCTGTG
GAAGCTGACTTTTACGCGATCAGTGCTTCTTTTGCAAGAAGAAGCTGTCATCGCAGTGCGAGAAGACGAGCTCCAACTCC
ATGGGAAAAGCCATGTACGGATCGCAGACGGCTGGCATCTTTGGCTTTGGCCATTTCACCGGGGGGTTCGCCGGAGGGCA
AAGGCAGGAACAACGAATCCAAGTCCCAAGCGTACAATTATTTGAGAATAGATGCTGACAGTCCACTATAGCGAATATGT
CAGGGTTCCGATCGGAGATGTCAACCTGCTAAAGATCCCGGATGACGTCCCAGATGAGAAGGGTAAGCTTGGCACCAAGT
ACGAGGTACGAACAAACGACGTCACGGTCGCTGACATTCGTGGCCAGCACTGTATCTCTCTGACGTTCTCGCAACGTCGT
ACAACTGCGTCAAGGACACGGCCGTGTACCCGGGCGACGAGGTCGCCGTTTTCGGCGCCGGGCCGATCGGCCAAATGGCA
GGCATCTTCGCCTTGGGAGAAGGGGCATCCAAGGTGATCTTTGTCGACACGGAGCCGCGGCTGTCGTTTGTGGCCAGCCG
GTGGCCGTCAGCACACAAGGACAAGCTGGTGCTCGTCGACTTCAAGAGCCTTTCCTCGGGCCTGACGAACAAGGAGACGG
TTGTGTCCAAGCTGAAGGAGATCTGCGGAGGTCGCGGCCCCGACTGCGCGCTTGAATGTGCGGCGGGCGAGTACGCCAAA
GGCTGGACGCACTGGTTGGAGATGCAGCTGGGCATGGAGACGGACACGAGCGAGATTCTCAACGAGATGATCGAAGGGGT
GCGCAACTACGGTCGTTGCGGCATCACCGGCATCTACGTTGGCTATGTGGGTCATGCAATACTACTGTGTCCACTTGGCA
CATGGCAATCGCCGGAACTGACCGTGGCCTATCTATGCAGACAAACCACCTGGCGATTGGGTCCGTCATGCAGCGCGGAA
TACGACTCATCGGCAACGGCCAAGCCCCGGTGCTCAAGTACTGGGACCATCTGCTAGCATTGATCCGGAAAGGCGAGCTG
GATCCGCTGCAGATGGTCTCCCACCGGTTCCGGCTGGACGACCTGGCCAGCGTGTACCATGCTTTTGACGCGAAGGAAGA
CGGGATGCAGAAGGTGTTTGTGGAGACGAAATTTTCGTTGCCCAGAGCGCCGGGGTCCCCAGAACTAACGCGCTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62