GenePrediction:GLEAN_7019 Details

Name: GLEAN_7019
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:285177..284338 (- strand)
Length: 840
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:285177..284753 (- strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_108:284698..284338 (- strand)
Length: 361
>GLEAN_7019 class=GenePrediction position=GCSC_108:285177..284338 (- strand)
ATGGCCAGGCATACAGCCCTTCTTGGCCCCACAACCCTTGACGCAAGGCCACCTAAGATTATCGCGCTCCGATTTGTAAA
TCGCGAGAGAGAAGAGAACCTGGGCGAGGAGTACCTTGTCCGGGTGAACCCTAAAGGTCAGGTGCCGGCCATGACAGGCA
ACGTGCTTGAGCAACCTCTGACCGACAGCGAGTCTATCTCACTCCACCTGGCCGAGAAACACTACCCGTCCATGCTACCG
ATACAGCATGCAGCTGTCATCAGGGGCCTTCTCGACCAGTTCCATTCCATCCATGGTCAATCGTTCAGCAACAAAAGACC
GACAGCCGCGATGGTGCAGCATAACCCTTCGCCTGTGGAGGGCTTTCTCAAGAGGACCGATCTCAGCCCAGAATACCGCA
GAGCTCTTGAGACCAAACTTTTATTGTAAATAGCCCCTCTGCCTTTATTGGTCTGTCTACTCTGACCAACACACCCCAGT
CACAATGAGAACAATGGCGTGGCTTTCCACCCCGATGTCGTGGCCAAAGCCAAAACAGATCTGCAGGCCATCTTCGCAGA
AATTGTAGAGCAGCGCAGGCAGAATGGCACCTATGGACGTTCTGATGAATGGATATTTGGAAGCAAGGTTGGCCCGACCG
TGCTTGACAGCCATTTACTTCCGCTCGTGTTGCGCTGCGTCGACGCCGAAAATTCGGAGCTCGTACCCGAGGAGCTGCAG
CACTGGGCCACGGACAAGGCCAAAAGCCCGGCGTGGCAAAAGGTCATGCATGGCAGGCCAACGCGGTGGGATGAGTCGAT
GGGCCGCATCGAGGACATGGAAGACATGAGATCCTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62