GenePrediction:GLEAN_701 Details

Name: GLEAN_701
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1528735..1530192 (+ strand)
Length: 1458
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1528735..1528878 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_97:1528945..1528978 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_97:1529036..1529352 (+ strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_97:1529439..1529985 (+ strand)
Length: 547
Type: CDS
Source: GLEAN
Position: GCSC_97:1530044..1530192 (+ strand)
Length: 149
>GLEAN_701 class=GenePrediction position=GCSC_97:1528735..1530192 (+ strand)
ATGGCTGACGAACCGGCCGCAAAACGCAAGTGCCTTGGGGCCGACTGTGACAATGATGCTGGGACGCTCCAGTGCCCGAC
TTGTATAAAGCTTGGCATCAAGGACAGCTTTTTCTGCTCCCAGGAATGCTTTGGAAGAAACTGGGTTAGCTCAGTCCCAA
TGTTTGAAAACGGCATCACTTCTGCCAGAGCTAACGTAAGGATGGCCTAGGTGACGCACAAGTCTATGCACAAAAAGGAG
ACGAGTACGCAGCTGCCTAAAGCTCATAGACCTTGAGAATCTGTATGCTGACGTAGGGCAGAGGTCGGATACTTCAACCC
TTTCCCGAACTTTCACTTCACCGGACCGCTCCGACCTGTGTATCCTCTGTCTCCTCGGCGCACTGTTCCGAAGTCCATAC
CCCACCCTGATTATGCGGAAGACGGCTATCCCAAGACGCCGCGCTCACGCCTGCGGCCAAACAACATCGAGATTTTGGAT
GCTAAGGCCCAGAAGGGCATGCGCAAGGTGGGCCGTCTGGCTCGCGAGGTGCTCGACATCGCAGCAGCCGCCCTGCGACC
TGGCATCACGACGGACGAGATCGACGAGATAGTGCACAAGGCATGCCTTGAGCGTAATGTCCGTGACCTGCTTGCTATCC
CAGCTGTTATTTTTCCCTTTGTTCTGACATGTTCCCTCTCCCCCGCCGCCTCTGTCTTGCGTAGGCCTATCCGTCTCCTC
TGAACTACAACCACTTCCCCAAGTCGGTATGCACGTCGGTCAACGAAGTCATCTGCCATGGTATCCCGGACAAGCGCTTG
CTTATGGACGGCGACCTGGTCAACTTAGACGTCACCCTGTACTATGGAGGTTATCACGGTGACCTGAACGAGACATACTA
CGTCGGAGACCGCGCCAAGGCGGACCCGGACACTGTGCGTGTGATCGAGACGGCGCGGGAGTGTCTGGATATAGCCATCA
AGATGGTCAAGCCGGGCACTCTGTTCCGTGACTTCGGAAACGCCATTGAGAAGCATGCCAAGGAGCGCAACTGCACGGTC
ATCCGAACGTACGTCGGCCATGGTGTCAACTCCGTCTTCCACGCCCCGCCAAACATCCCCCACTACGCAAAGAACAAGGC
AGTGGGCGAGTGCAAGCCCGGAATGACGTTCACGATCGAGCCCATGGTTGCTCTGGGCAAGTACCGTGACGTGACATGGC
CGGACAACTGGACTAGCACGACAATCGACGGCAAGCGGACGGCACAATTTGGTAAGTTGTCCCGCAATCTGCAGTGCATC
CGTCTATCGGCCGCTGACAACAGCCACAGAGCATACCCTGCTCGTCACTGAGACGGGAGTGGAGATCCTGACGGCCAGAA
AGCCAGACTCGCCAGGTGGGCCAGTACCATATCCGGTCCAGGCGAGTGCGGAGCCGACGGAAGAGAAGGCGAAGGAGGAG
GAGGAAGTCAAGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62