GenePrediction:GLEAN_7020 Details

Name: GLEAN_7020
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:284074..282977 (- strand)
Length: 1098
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:284074..284070 (- strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_108:283688..282977 (- strand)
Length: 712
>GLEAN_7020 class=GenePrediction position=GCSC_108:284074..282977 (- strand)
ATGCGGTACGGACAATTGTACACATTCTGCTTATATCACCTTCGTCGACGGAGCTCGGGACCTAGGTTCACCGATCTGGC
ATTGTAAGATCGGCTTAATAAACGCCGGTGTCTAATAAGCAAGTGCCCAGATGCAGTGCGGATCTTCACTCACAGTCGAG
CATTGGTAAGCATGAGCAGTTTATAAAGGCAGGACAGTTCGCCTTATATCCGTATATTTTATTTCAAAGTCATCAGAAAC
ACCACTTGCATTGCACTCGTAATCACAAGATGGTTGCCATTCAAACTGTTCGCGCGTCTAACGTCCGCATTGCGGAGCTT
CCTGGGGGCCTTGTTGCGCTCTTCCTTGGCGCCACGAGCGGCATTGGCCAAAGCGCCTTGCTCCAGTTTGCAAGATACGC
CGTGCGGCCCCACATCTACATCGTTGCCCGCCACGCCTCCGCGACAGACGATGCTGAAGGAGCTCCGTGCGCAAAACAAG
GAGGCCGTGTACACCGTGATTGAAAAGGACGTATCGCTAATCCGCGAGACCGACGATGTCGTTGACTTTGTCAAGACTCG
CGAGACGAAGCTAGACCTCCTGTTCGAGTCGGTCGGCTTCATCTCCTTCTCGGGCCGTCAGGAAACGGCCGAGGGCCTCG
ATGCCTCCATGTCGACGCGTTACTACAGCCGGCTGCGCGCTGTACAAGGCCTGCTGTCGCTACTTAACGAGGCCTCAAGC
CCGCGCGTGGTATCGATCCTCGCCGGCGGGCAGGAGGTCAAGCTGAACGACGAGGATCTGGACCTGCGCAAACCCGGCAA
CTACTCTATCGCAAACGCAGCATATCACTCGGCAACCATGTTGACACTAGCATTTGAGCATCTCGCTCGCGAAAATCCGC
GCATCAGCTTCGTGCACGCATTTCCGGGCGTGGTGGCGACACCTCTCTTGTCGAGAGGATCGACTGGGATCAAGCGCCTG
CTGATGGCCGGCATCGTCCAGCCCCTGGTCAGCCTGTTTTCCCTTTCCGTCGACGAAGCGGGCGCTAGGGCTCTTTTCTA
CCTGACTAGCGACCGGTATTCGTCCAGCGGCAGTTTAGTGCCACTAGCTGAGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62