GenePrediction:GLEAN_7024 Details

Name: GLEAN_7024
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:269468..268080 (- strand)
Length: 1389
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:269468..269271 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_108:269205..269169 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_108:269112..268593 (- strand)
Length: 520
Type: CDS
Source: GLEAN
Position: GCSC_108:268533..268080 (- strand)
Length: 454
>GLEAN_7024 class=GenePrediction position=GCSC_108:269468..268080 (- strand)
ATGGATCCAGCCATTCTTGCCGTCTTTGGGTCGGCGCCCGATGGCATCAACCTCAAGGCAAACCGAGCCGTCCAGAACGA
CGCGGCTGCTATTACTGTAATCATTCTGGCATTGATTGCAGTCATATTTCGGTTCATTGCGCGCTCCATCCAGCGAGCTC
CTATCAATCGTGACGACTGGGTGATTATCTTGGCTCTGGTAAGAGACGCTCTACAGCCTACATAAGCAGGCCTCTTTCGG
CTAACCTGATTGCCTCTCTGGAGCTGTTTGTCATGGGTACTGTCGGCATGAGTGTGGCCGGTGCGTTTGCCCCATTCCCC
TTGTGACAGCTGTCCTGCATGCTAACGGGGTCCTAGGCGGAGCTATCGGTGCTGGAAAACACATCTGGGCCACTGACATG
GACCAGCTTACACTCATTTTCAAGGTGATTGCGCCTGCTCTCAGTCTTTTCAGCACAATTCGTAACGGGGGCTTGACTGA
CAGCAAGCAGATTCTCTACTCATACACGTACATCTATGCGGCTTCTTGCGCGTCGACAAAAATCTCCATCCTTCTCTTTT
ACCAACGCATCTTTCCCTCCATCAACACGGCCTTTAGGCTTTCCGTCATGGTTGGCTACTTTCTATCCTTCTCATACCCC
CTCATCATCTGGGTGACAATGGCCAACTGCTGCAAGCCTCTGTCACACTATTGGAATCAATTCAGCGGGGCCAAGGGCAA
ATGCATTGATGTCAACAAGTTCTTCCTCGCTCTTGGCATCATCAACATGCTCAACGACGTCATTATTCTGTCCATTCCAA
TTCCTCTGATTCTAAGCCTGCAGCTCTCTCTCCGGAAGAAAGTGGCCGTGACCGGTATTCTGCTTCTAGGGGGCTTGTAC
GTATCCCTTCTTATATTTCTCAGTTCCTATCCCCATTGACATGTCTTTCTCTTAGTGTATGCGTTGCCAGCGCCCTCCGC
ATATACTACCTCACTGTCTTTTCTTCGTCCACAGACCTGACCTGGGTTATGGGTCCCGTTTTTATATGGTCTGCCATCGA
GCCCTCGATCGGTATCGTATGCGCCTGTCTGCCGCATCTGGCGCCACTTTGGAAGCTCTTCCATCTCAAGGTCACAAACG
TCTCTAGCGGACAAAAGTCAGGCGCCAACTCTGCCGGTACTCCTTGGCGGTCTACGGGCGCCCAGCCCTACAGCAGCAAT
TCTCGATTCGCCTTTGGGGGAGACAAGATGATGAAACTGGGACCCTCTGACGACGAGATTGGCCTGACCAACCAAGCTAC
AGCCGGCTCGACCGTTGGTAAACCACGCTCGTCTGGCTCCGGCTCCGAGGATAATATCAATGGCATCATCGTCAAGTCTA
CATTTGTTCAAACAGTATCTTTGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62