GenePrediction:GLEAN_7028 Details

Name: GLEAN_7028
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:244196..240636 (- strand)
Length: 3561
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:244196..243769 (- strand)
Length: 428
Type: CDS
Source: GLEAN
Position: GCSC_108:243691..243580 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_108:243494..240636 (- strand)
Length: 2859
>GLEAN_7028 class=GenePrediction position=GCSC_108:244196..240636 (- strand)
ATGATGGAAAGGATTGGCTCCTCCACTCAACCCGCCGGCCGCGGACTGCCGGAAAACCCAGCCCAAGGACGACGCTTACC
GATGCCTGCGCCAACCGTTCCTGTCCCTCCCATACCGCTGTCATACGCGACGTCCAATCTGGCGTCCAGCGCGAACATCG
CCCTGCCCCCACCGCTGCCCCCACCCCTTATGGCGCCCCGAAGCAGCAGCTCGAGCCTGACGGCTTCGGCTCCTATCTCG
CCCAGTCAGGTCATTGTATTGGCACGCGAGGCCATGAAGGAGGCGCTGCGGCACAGTGACCAGCAAGCGGGTGAAGATGG
CGGTGTCAGCAACGAGCTCGCACCCGGTCTCACGATCGACCTCAGCCGGAAGAACATCCAGAGACTCCCCGACGAGGTGG
TGGATATCATCATGAACAAGCTGGAACGGTATGTTTGCATGCGGCTATCCTGTCTGTCGGGTTTGGTTTTTCTGCTGATC
TCCCTGCTGACATTCTTACCGATAGTCTCGCCCTGTCCCATAACAAGCTGTCGGCCTTTCCGGCGCGGTTCTCCGAGTGC
TCGTCGCTACGGTACCTCAATGTTCGCGAGAACGACATTCGGGAGTTCCCCTTGCCGGTAATTATTCCCCTCCCCCTTCC
CCTCCCCTTTTGGCTGTCTGTCATCTGTATGCGGTGTCTGACGTTGTGTTGTCCTCTTGCAGTTGTGCGACCTTCGCTCG
CTGGAAATCCTTGATTTGGGCCGCAATAAACTCCGAGTACTACCTCCGGAAATCGTCAAGTTGACGTCCCTGAAAGTGTT
TGCGCTACAGAAGAATCGAATCGAAGAGCTGCCGCTCTGCCTGGCCGACATGTCCTCGCTGCAGATGATCAAACTTACGG
GCAACCCGATCCGCTTTCCGCCACCAGAAGTGTTTCAGGTGCAGGCGAGCAGCCCTCCGAACGAGGGCTATCTGAAGGAC
AACGAGGTTACCGAAGTTACGATCACATCTCACATCCGACGATTTCTGAGGCAGGCGGCGGCAAACGACCGGGCCGAGGC
TGCTGGGCCTGTCGGGGCGACGCCTCTTGCCACCCTGGTCGGTGGGGGCTTATTCTCTGGACAGCGAGCCGGGTCGAGCA
TAGCATCGGACTCGGCTGCCGAGGACTCGTCTGACACGCTTGAGGCGCCGCGCATTATGCCGGTGAAACGGGTGACGAGC
GGCCGGTTTCCGATAAAGGTCAACGGCACCGAGCTAGGCGACCTCCGATCGCCGCCGCAGTCACGGCCACCACCGATCCC
CACACGGTCGCACTACCGCGGGCTCTCGCAGCAGAGCACGGCGGTTCGGCGACCCGGGGTGATGCCGCTGACAATCAGCA
GCGCCAACGAGCGTATGCGGAGCAACTCGGAGACGACGCTACTCCCGGCGCCGCGCAACGACCGGTCGGGCGACCGGTCT
CGGCGGATGGGCATCGTGTCCAAGAAGGCGCACGAACTCATGACGCTGGACGAGGACGAGGTGAGCAACGGGAATGCCAA
CCGGTTCAGCCACTACCGGGGCCTCAGCCACGGGTCGGCCATGCAGGGAGCGCCCAACGGGGGGACGGCGGTGGCGCCAG
AAACAAAGAGCCCAGCCAGCCCTGTGTCGGACATCTCGCTGCAGCGTCCGATCTACGTGCGGCGGCTGTCAATCCTGCCG
GAAAGGCGGCGAGAATCCCAGTTCTACGATCCGGTGGTCGAGTCAGCCAAGGGCATCCTCTACTCGGTCTTCCAGATCCA
TCCGACCATCCAGATGCTGCTAAGCCTAGCAAACGACGGTACAGCGCGGCACTCGAGCCTGGAGATTGTGTTTTATAACA
CGAACTCACACGTGGAGCAGCTTGAGCGGGAGATCCAGCGCCACGACCTGGCGGAGGAGGACAGCGAAATGGGCCGTCGC
GAGAACGAGACGGTGCACCGGGCATGCGTCACGCTGCTGAACGCGTACGACCACATCTGCTCGCTGCTTAAGGCAAACGT
GGACTTGTTCCTGGACAATGGCGATCCGCGATACATGCGCACGCTGCTGCTGCAGATATACCATAGCATCATGGAATTGC
GGGTGGCGTCGACGAGCCCGCTGGCGCCGCGGACGATGAACAAGGCGGTGTCGCACAGCAACGACAGCTCGACGGCAGGC
CGGACACCGATCAAGCATGCGGCTGGGCTCGGTGAGACGGTGCGGCCGATGCCTCCGATGATGGGGCCACTGCGAGACGG
CTCGGTGATGGTGACGCCGTCGGCCGATCGGCCAGGAGCCGGGTTGCGCGAGCCGCGGGGGTTTGTGACACCAAACCTGG
GAAACCTGCGGGTGACGACGGAAACGACGCCAGCAGGGCTGGCCGGGCTGACGATCAACGGCAGCGGGCGAACGGCGACG
ATCATGGCGGTGACGCCACGATCGGGCGAGTCATTTACGTCATCGAGCAGCCGGGGCGGGGGGGTGATCACGTCCGAGTT
CACAGAAGAGGACCGGATGTTTGAGAAGATCTTCTTGTCGCTGCAGAAGTCGACGGATCTGGCGATGCGGCTGCTGCCGG
GTTTGAGCAGCCAGTACGCAGGAGCGCTGCGGGCGGCGACGGCACAGCGAGCGCGGGAGCAGACGACGCGGTGCTGGCGG
GTTCTGCTGGCCAAGTGTGCGACAGCGATCCAGCACACGGAGACGCTGAAGAGTCGGCTGTCGAGCGTGAAGCTGAAGGA
GCCGGGGATCCGGTCGCAGTGGGCGTACTGGTCGGTGTGCAGCAACTTCCTGGAGGCGTGGCTGGACTTTGCTGGAGCGG
TGCGCGAGTCACACAAGACGATCCAGCTGCCGGCCGACACGAGGCCACGGATGCGACCGCTATATCAGTGCGTCAAGGAC
ACGATCGTGCTGATCATGCGGTCACCCTGGGCATACGCGCTCCGTCAACAGCAGCAGCAGCAGGGACAGCCGGGGAAGCC
GGGACAGCATCCGGGATTACAGCAGCAGCAGCAGCATCAGCAGCAGCAGCAACAACAACAACAACAGCAGCATCAGCAGC
AGCACCATCACCCGGGACAGTGGCAGAGCCAAGGACACGGCCATGGTCACGGGCAGGGCCAAGGTCCCGGCCAACATATG
AATGTCAACGGCAATTCGGCCAGCTCTGTGAGCTCTCTTAGCATGGGCAGCATGGGCAGCATCGATGGCGGACATCTGAC
GCAACTGCCGATGACGCCACAGAGCGCAGCGCTGGGGCCAGCGGTGCAGGCGACAGTGCCGTCGACACCGCAGAGCGCGT
CGTTTTCTCACGTCTTCTCAGGAAACGTGTTTGAGCGGGCGGACGCACTCATCAACACGGGTGGCCTCTCAATGGTGCGA
GGCGGGCCCGGGTCTGCATACGGCTCGCTGTCGGGCACGGCCAGCTTCAGCTCGTTTGGCAACACGAGCACGAGCAACAG
CAACAGCAGCCTGCTCTCGTCACAGGCCGAAGGTTCCATGACCCCGTCGTCGATGCTGAGTTCGGGGCCGTTGGGGCAGC
TGCCCTTACGGCTGGGCAACGGCAGCAAGATTGCGTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62