GenePrediction:GLEAN_7029 Details

Name: GLEAN_7029
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:225386..223489 (- strand)
Length: 1898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:225386..224962 (- strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_108:224829..223688 (- strand)
Length: 1142
Type: CDS
Source: GLEAN
Position: GCSC_108:223628..223489 (- strand)
Length: 140
>GLEAN_7029 class=GenePrediction position=GCSC_108:225386..223489 (- strand)
ATGGCCATTGGCGGCCTCATCTCCAAGATGGCCCACATGCAACCGCCGCTCGGTGAGCTGGACATGCGCGCAGCCGCTGT
GATGGCAGCGGCCGTAGGCAAGCCCGCGACTCTGATCTTCTGTGCTGTCGCCGGGATCGCCGTCCTGCTCTACCGCCTCG
TCGTCGTCCCGGCGCTGCTGTCTCCGCTGGCGCGCATCCCGGCGGCACACCCGCTATGTCACGTGACACCGCTCTGGATC
CTCTGGGTGCGGTATCGCGGTGTCGAGACGAGCACGATCCATGCGCTGCACCAACGGCTGGGGCCGATCGTGCGGACAGC
GCCCAAGGAGCTGAGCGTGAACTGCTTCGAGGGCGGGATACAGACGATCTACACCGGCGGCTTCCACAAGACGGACTTTT
ACCACAACCGGTTTGCAAACTATGGGTGAGGCCTGTTTCTGCTCTTTGGGCTTGCATATTTCCTGGTGTTCGATTTGCAT
ATCCGCTCATTATTGCTCCTTCGTCAACTCTTCCCCTGCTCTGATGGCACCTCGCCACCTTGCACTAACCCTGGCAGTGT
CGACCCCATGTTCGCCATGTCCGGAAAAGCCCACGCTGAGCGCAAGCGCATGATGTCCAATGTCTTTTCCAAATCGTACA
TCCTGGCCAACGTCACGGCGTTGGCTGTCGTGCGGACCGTGCTGTTTAAACGTCTTCTGCCGCTGATCGACGCTGCCGCC
ACCGCGGGCGAGCCACTCGAGGTGCTCTCGCTGCTCGCAAGCTACTCCATGGACACCTTTACCGGCTACCAGTTCGGGCT
GGCCGGCGGCACCAATTTTCTGCAGGACACCGACGAACGCCGCTGGTACCTTCGCGCTTTTTCTGAGCGCCAGCCGTGGG
CCTTCTGGAGGGCTGAGCTGCCACGTCTGACGGCCTGGGCACAGCATCTGGGCCTCCGACTGGTGCCGCATTGGGTCGCG
AAGGACTCGGCCGATCTTGAGACCTGGCAGATGGCCCTCTGCGACCGGGCTGAGGCGCGCATGGCCACCGCCAGCACCGT
GTCCGTCCAGGATGTACCCGTCGTCTTTGGCCATGAGCGTGCTGCCTTTGCGAAGCACGATGACCCAGAAACTCCCAGTA
GCAGCCGGCCTCGACAGCTGGCCCAGAAATCCCAGCCAGCCCGGCCAGACGTCCACCGGCTCGAGATCGCTAGCGATATG
TACGACTACAATGCGGCGGCCCACGAGACCAGCGGCAACACGCTGACATACCTCTTCTACGAGCTGTCGCGCCGGCCTGT
CTTGCAAGATGCCCTGCGCGCTGAGCTGCGTTCGCTGGGCCGCGGCCTCGTCTACCCCCGGCTGCCCGGCCAGGATGTCG
ACCTTCCCGACCCAAAGGCCCTCGACCAGCTTCCGCTGCTCGATGCCATCCTACAAGAAACGCTGCGTCTCTGGTCGGCC
GTGTCTGGCGGCCAGCCTCGCGTCACACCCACGTCCTCCTGCTCGCTGGCCGGCTACGACAACATTCCCGGCGGCGTCCG
CGTCCAGGCCCAGGCCTACACTCTACATCGAAACCCGGCCGTCTTCCCCGAGCCCGACAGCTGGCAGCCCCAGCGCTGGA
TGGGCCAGACTCCCGAGAAGCTCGCCCTCATGCGGCGCTGGTTCTGGGCCTGGAGCAGCGGGGGCGCCATGTGCATCGGC
AGCAACTTTGCCACGTATTGTGAGTCTTTCTTTGAATATATCCTGCGTTCGTTGCTTCGTCCAGTTCTAAACTCCTAGCC
ATGAAATTCGGCATCGCTTCCGTTTACACAAACTACTGCACCGTTATTGTCAATTCGCCTGATATGACCCTGTCAGAAGG
CTTTACTGCTGGTCCAAGAGGAGGGAAACTGGATCTACAGTTCCAGCAGGCAGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62