GenePrediction:GLEAN_702 Details

Name: GLEAN_702
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1530888..1532884 (+ strand)
Length: 1997
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1530888..1530974 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_97:1531077..1531110 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_97:1531199..1531356 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_97:1531417..1532098 (+ strand)
Length: 682
Type: CDS
Source: GLEAN
Position: GCSC_97:1532166..1532884 (+ strand)
Length: 719
>GLEAN_702 class=GenePrediction position=GCSC_97:1530888..1532884 (+ strand)
ATGGCGCGTTGGATTTCCAAGATGCTGGCACCGCTGGCGCTGGCTCTTTGTGCAGCGACGGTAGCCCATGCCTTTGAAGA
GAAAATTGTACGTGGTCCCAGCTGCATGTCGGATGCGAAGCTTGCGCTCTTTGTATGCGCGCGCACATGTGTGCACCTGG
ATCCGTGCTGACATTGCATCCGTGAACAGAACCAGAAGGACGACTACAGACAGCAATGCGCCGGTACGTGACGACGGAAA
GGCTGAACTATGTGTCCGGAGGCTTGAACAGTGGTGAAGGTGGCCTGGCTGACGTGGATATTGCATGGCAGGTATGTACA
GCAGAAAATCCTGGGGCGGCCCTGCGGACCCGTTCATCAGCGTCGTCTTCGACAAGTACGACGGGCCGGTGGACCCCATC
GTCAGCGTGCTCATTTTTGAGTGGAAGGATGAGGCGCTTATCGGGATCTTACCGGACGAGAACCAGCAAGTATGTATTCT
GCTTCGTGCGTCCACGTCGGGGACAGGTATAGCTGACAGTGTGTGGTAGAAACTCATCATCTGCGAGCCGCAATATGTGT
CGCAAGGCCACTGCAACGCGTCGGATGTCGGCAGGTTCATGTTGCAGCCAAACGCGACAGAGGCGTCGAAGAACCCGATC
TACAACAAGGCGGTGCACCTCAAGGAGGCCCAGCCGATCATGTACGAGATCAAGAAGACGGGCTACTTCTGCATTGTGAC
GGCGCCGTTTAGCGCCTCCGAGTACAGCGCGGTGGCGGAGTTCCGCAGCGCGTACGGTGAGCTGCCGGCGACACAGATCC
CCAAGCTGCCGTTCTACGGCGGAATCACGATATCGTATGCGGTGGTGGTGGCGTTCTGGGGGTTCATGTACTACCAGCAT
CGCAGCGACATCCTGGCAGTGCAGAACTACATCACGGCGATCCTGATCTTCTTAGTGGCGGAGATGCTCATGACCTGGGG
CTTTTACGACTTTATGAACCGCAAGGGCTCAAGCGTGGGAGCCAAGGTGATGCTGGTAGTCGTGGCCGTGCTCAACGCGT
TCCGCAACTCCTTCACCTTCTTCCTGCTGCTCATCGTGTGCATGGGCTACGGCGTGGTCAAGACGTCGCTGGGTCGGACG
ATGATCTACGTGCGCTGGCTCGCCATCGCACACTTTGTCTTTGGCCTGGTGTATGCCATCACGAGTCTGCTGGTCAAGCC
AGACGATGTTGGTGAGTAGTTGCGATGCGATGCTCGAGCTGCGTGTGGCAAGAGGGCATAATTACTAATCAATAACAGGG
CCCTATGTGCTGCTCATCATCCTCCCGCTGGCGGCGACGCTGACGGCGTTTTATGTGTGGACGCTCAATTCGCTGAACCT
GACGCTCAAGGACCTGCGGGAACGCAAGCAACATGCCAAGGAAAGCATGTACAAGAAGCTATGGTGGTGCATTTTGCTCA
GCATCGTGGTGATTTTTGGCTTCTTCTTCCTCAACAGCTTCTCGTTCGCGTCGGCTAGGGACCCGGACTTTGTGCCGTTC
CATTGGAAGACGCGGTGGTTCATTCTGGATGGCTGGCCGAACCTGGTGTACTTTGCAGATGTTGCGTGGGTGGCGTACGT
GTGGCGGCCGTCGGCCAACAACCGTCGGTTTGCGATGAGCGACGAGATCGCGCAGGACGACGACGGGACGTTTGAGATCT
CCAACATGGATATTGGCGTGCCGGAGGAGTTCGACGAGGACGACGAGGACGGCCTGGGCAACGGACAGCGACAGGAGGCC
GGGGGACTGGATCGCAGCGGTGCAGCGGGCGTGGAAGAGGCGACGATTGGCAGCAAGCCGACAGCAGCGAGCAGGTCGGT
ACAGGCGTCGTCGTCGACAGCAGCACGGGACTCTCTCGACGGCGAGACCATCTTTGCGGTAGGAGAAGATGCGGACAAGT
TCTCAGACGACGAGGAAGACGACGACGAGGAAGACGATTCGGAAGAGGAGTCTGGCCTGGTGCGAAATAAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62