GenePrediction:GLEAN_7030 Details

Name: GLEAN_7030
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:220045..216517 (- strand)
Length: 3529
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:220045..219422 (- strand)
Length: 624
Type: CDS
Source: GLEAN
Position: GCSC_108:219363..217473 (- strand)
Length: 1891
Type: CDS
Source: GLEAN
Position: GCSC_108:217268..216517 (- strand)
Length: 752
>GLEAN_7030 class=GenePrediction position=GCSC_108:220045..216517 (- strand)
ATGAACTTCGGACGACTTTTCACCCTGTTCTGCTACACGCCACCCTCAAACATCATGGATGTAATAGATTGGTTGAAGAG
CAAGGTGAAGGGGAAAAATGCGCAGGAGCATAACGAAGTTTTGTCTCTTTTCAAGGCAGCGTTTCCGCCAGCTGTAGCTG
TCGGATGTGCCACTATTGCATGTGCCAACAATCCCTTGAACTGGGACCTGAAAGGCCTGCCTCAAGCCCTGACAGCATCC
GACTCTGCCTTGGAGTCTGTTTCTGATGATTCATCGACCGGTGATGCATACGGTCTGTGGGCACGAGCATTCGAACTGGC
CGAAAAGCAAGAAGAAGTATTGATGAAAGATTACCAAGCACATCTCCGTTCACTGACTGGGGTCTCGAAAAGCGGCGTTT
CGTTTGTGCGCCCTCCGTTGGTCGAAGAAGCCGTCAAGGTACTTGCAGAAGAGCGAGAAAAGAAACAGTGGAGAGTTCAA
GTCGGCGGCTGCGATGTCAAAATCCGGGAGCAGGTAGACAGGTTGAGACGGTTCATTGCTTGGTCCGACCAGATTGTCAG
CCCTGCGCTCTACACACAGCCTTTTGCACAGCTGGCATGGTCTAGTGTTACGATCCTTCTTCCTGTACGTAGCAATCTCT
CCAACGCGTGGGCAACCCTACTTACCAGTGTCGCCGTTGCAGCTGCTGAAGAACGCCACCGGCCAGCATGAGGTCATGCT
GGGAGGTTTCAACACGACCTGCAGCATCCAGGCGTACTGGAAACTATGTGAGGACGTCTATTTGAGTCGTGAGAGCATCC
AAAACTACACAGAGTTCAGCGAGAACTTGGCCAAGCTCTATTCCTGCATCGTCCTATACCAAGCTCGAGTTATTTGCCAC
CTCTCCAGAGCTCAGCTCTCCCGTTGTTGGAAACACGTGACGGGCCAAAGTGTCTGGGAAAAGAGTAAAATGGAGCTTGA
AAGCCTTAATGTGACCTGCCGCGGATTCATCGACCCTATCCGAGAGCGGGTGGTCAGTGACCGTTGGGACAAAGCGCTAA
AAACAATGCGGGAATCCCAGGCATATCTAAGCAAACTCACGTCCATTACCGAGGAAGGCCATAAACAGATGCAGAGAAAC
TATGAACAGCAGAATGAGAAGCTTCTTCTCCAGGACCTTGCTGCAGCTTTCACAGACCGGTCCCTTGATAAGCAGTGGTC
ACCAGACAAAGGGTCGGGCCTGAAGTCATATAAAAACATTAACCCAAAGAGGGTGCCAGGCACCTGTGAATGGTTCTTCC
ATGATAGACGGTTCTGCACGTGGCGAGACTCGGATTCATCCAGGCTACTGTGGGTATCTGCCGGACCTGGGTGTGGAAAA
TCAGTGCTGTCACGGGCTCTTATTGACGAGAAGCGGCTATCCACAGACCCGACAGCAACGATCTGCCACTTTTTCTTCAA
AGACGGAGATGGACGGCGTATGTATGCAACCAATGCACTCTGCGCACTGCTTCACCAAATTTTCACTCAGGACCAGAGCG
GCAGGCTCATTGATACTGCCGTTGCCAAGCATGAGAAGCAGGGAAGTGCCGTGGTCAACGATTTCTATGAGCTTTGGGAC
ATCCTGGAAACCTGCGTGGAGTCGCCCTATGCTGGGAACATCATCTGTCTTATCGATGCTCTGGACGAGTGTTCAAAAAC
AAGCAGAAAATTGCTGATCGAAAAGCTGCGAGATTATTACAAAGCCGTTGATGGAACAAAGAGTTCCAGCAAGCTCAAAT
TTATCATAACTAGTCGCCCCTACAGCCGCATACACGAGTCGTTTTCTACCTTTGGGGATACCGCCGGCTTCGTTCACTTT
GACGGAGACGGAAAGTTTCGGAACATCAGCGAAGAGGTCAACCTGGTCATCGACTACAAAATGAACGACATTGCGAACCG
TCTCTCCGCACAAGACTGCAAAGACATCACGGCTAAATTGAAGAGTATAGAGAACCGCACATATCTTTGGCTGAAGATCA
TATTTGACACCATCGAGGACGATCCCGCAGAGTATAACAGACGATGCGACGTGGACGAGCTGTTGTCCAGCATACCAAAC
GATGTCTTCGATGCGTATGATAGCATCTTGAGTCAAACGCTAAACAAGCGCCGCGCGCAAAAACTTCTCCAGCTTCTTCT
TGCAGCCAAGAGGCCTCTTCGTCTCGATGAAGCAAGCGTTGCACTTACTGTCCAGGATGGGAGTCTCCCGAAAATGTGGG
AGCCAGGCCAATTTGAATCTGTGGTGAAAGATCTCTGTGGATTCATCAGCATCCAAGACGACAAATTGTCGTTCATACAC
CAGACAGCGCGGGAGTTTCTCATACACAAGGACAAACGGGGAGGCTGGCAGGGCCACTTCGGTCTGAAAGAGTCGCACAG
GATCATGTTCCAAGCGTGTTCCGACTACTTACTGTTGCCAGAGATTGACACGCCAAGGAAACGGATTGACCCGTTTCTGT
CTTATGCTGGTGTATACTGGCCTCTGCACTACAAGTCACAGGAAGCATCTCTGGTTTACAGCAACCGAGAGACAGCAGCG
AGACTTTGTCAATGTACGCAATCTGGAGAGAAAAAGGCTTGGATGGCTGTGCACGAGACGCATCTATCAACGCAGTGGAG
TCAAGTTTTCGGTACAAATTGGACTGACTGGGCCATTCTACTCCTGGGAAGCTTTTTTGACTTGAAAGAGGCAGTCAGAG
ACACACTAGCCAAAAAAAAGAACGAGGGCATTCAAGCACACGATATCTACGGAACAGCTTTGAGAGTAGCTGCGGAAAAG
GGCCACGAAGAAGTCGTCCGTATACTGCTTGATCACGGCGCCGACATTCACACAATGAACGGCCGTCATGCGCAGATAAT
GGCGGCGAGGGGAGGTCATGTCGGCGTACTCCGTTTACTGCTCGAGAGCGGTGCTGACGTGAACGCAAGAGATCCTTCTG
GAAAAACAGCATCACACATCGCATCATTGCGCGGCTATGAAAAGGTTTTGCGCTTGTTGATTAACAACGGCGCTGATCTG
TTCGCTGAAGATCACGGTGGGAGAACATCATTATACCTCGCATCAAGCCGTGGCCATAAAGAGATCGCCCGCATGCTTGT
TAGCAACGGCGCCGATGTGAACGCAACGAATCACGAAGGGCAAACGGCATTGCACTGCGCATCCAAGGAAGGCCTTGAAG
AGATCGTCCGATTGCTGATCGACAGCGGCGCCGACGTGAATGCAAAAGCAGGTCTTAAAACAGCACTATGTCTCGCATCA
AGCAGCGGTCATGCAGAGGTTGTCCGCATGTTGGTCAGTAATGGCGCTGATGTCAATGCAGATGATGCAAGTGCAAAAAC
AGCATTGCACTGCGCATCAGAGGAAGGTCACGAAGAGATCGTCGGCATATTGATTCGCAACGGCGCCGACGTAAATGCGA
ACTATTTTGGGATGACACCGTTAGAGTTTGCTACAGGCCATAAAGGTGTTGCAACTATCCTAAAGGAAGCGGGTGGGATA
ATCCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62