GenePrediction:GLEAN_7031 Details

Name: GLEAN_7031
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:210455..208668 (- strand)
Length: 1788
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:210455..210258 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_108:210195..210115 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_108:210061..210010 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_108:209955..209203 (- strand)
Length: 753
Type: CDS
Source: GLEAN
Position: GCSC_108:209122..208668 (- strand)
Length: 455
>GLEAN_7031 class=GenePrediction position=GCSC_108:210455..208668 (- strand)
ATGGCTGAAAAGATGGAGAAGACCATGGGCCTCGCCGCGGCCGTCAGTGTGGAAAAGGACGTGCTCGAGGTGCCATCCCA
CGGCCTCGAGGCCGTCGACAACGCCTACGAGTTCGCCAAAGAGAACCATGCCGGACCCATCAGCGACGCCGAGTACAAGC
GGCTGCTGCGCAAGATCGACCTGCGTCTAGTTCCACTGGTACGTCGAAACGGAACGGAGACCACAGCTGGTCGATTGGTT
CACGTCCGCTGACAGGTCAGATGCTCATCACGTACACGCTCAACTTCATGGACAAGAACACCATGTCTTACTCTGCCAAC
TTTGGCCTCATCACGGACAATGTATGCGCCTTTCCCTCTGCTCCGTGACCCTGGCCAGCAGCTGATCAAGACAGCACCTG
AGGGGCAAGCAGTACAGCTGGGCTTCCGGCTCGGTCTTCTACCTCAGTCAGTCGCCGTGTCCCCCAGTCTCCTGTCTCCT
CTGCCATGCTGACTAAGCAGCCTACCTCGTCTCGCAACCGTTTGTCGCCCGGCTGATCGTCCGGTTTCCCATCGGCCGCT
TTGTCGGCTGTGCCACGATCCTGTGGGGCGGTGTGCTGATGACGATGGCGGCGTCGCGCTCGTTTGCCAGCCTGATGGTG
ATCCGGGCCATCCTGGGCTGTCTGGAGTCGTGCATCAACCCGGCCTTCATCGTGATCTCGTCGCAGTGGTGGACGCGCGA
GGAGCAGCCGCTGCGCATCACGTTCTGGTATCTGGGCAACTCGATCGGTCAGGTGTTTGGCGGTCTGCTGGGCTACGGCA
TCGCCCACATCCACCGCACCAGCGTGCCCAGCTGGGGCTTCTTCTTCCTCATCTTTGGGTCCGTCACTATCGTCTTTGGC
AGCTTCCTGCTCTTCTACCTGCCCGACTCGCCCATGACGGCCCGCTGGCTGACGCCGCGCGAGCGTGCCATGGCCGTCGA
GCGCGTGCGCGCCAACCGCACCACGATCGAGAACCACACCTGGAAGTGGTCGCAGTTCGTCGAGTGCATGCTAGACGTCC
AGGTCTGGGTCCTCGTCGCCACCTTCTTTCTCGACGACATCCCGGCCGGCGGCGTCGGCTCCTTTGGCAGCATCGTCGTC
AAGGGCTTCGGCTTCAGTCGGCTCTACTCTACCCTGCTGCTCTGTCCGCTCGGCATCATCCAGGCCATCTGCATCCTGTT
CGGCGGCTTCATGACGCGCTACTTCCGCAACGCCCGTCTGTGGCTGGTAGTTGGTGAGCCATTTTCGCGTTTCTTTGTAT
TCTCTTACCGTTTCCCTTTCTTATACGTGTCATCTCCCACTAACGGACCACAGGCTGCCAGATCCCCGCCCTCATCGGCG
CCGTTTTGCTCTACACCCTGCCGCGGTCGAACCGCAACGGCCTTCTGGGCTCATACTACATCGTTCAGACTCACGGCATC
GTCGGAACGCTGACCATGTCGCTGGTCTCTAGCAACTTTGCTGGCTACACTAAGAAGGCCACTGCGTCATCGATGTGCTA
CGTCGCCTTCTGCGTCGGCCAGGTGGTGGCACCGCAGCTGTTCCTGACAAAGGAGGCACCGGCCTACGAGACTGCCTTCC
GCGCCGCCTTCATCTGTTTCGGGCTCAACATTGTGCTCTGCACACTGCTGCGCTTCTACCTCATATGGGAGAACAAACGG
CGCGACCGGCTAGCAGCTGTGCAGCCGACGCCACCAGCCGGGACCAACGACGAGTTCCTCGACCTGACAGACAAGCAACA
GAAACTCGTGTTCCGGTACATGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62