GenePrediction:GLEAN_7034 Details

Name: GLEAN_7034
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:195051..192505 (- strand)
Length: 2547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:195051..194882 (- strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_108:194822..194668 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_108:194600..193979 (- strand)
Length: 622
Type: CDS
Source: GLEAN
Position: GCSC_108:193857..193782 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_108:193731..193613 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_108:193562..193252 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_108:193181..193050 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_108:192983..192505 (- strand)
Length: 479
>GLEAN_7034 class=GenePrediction position=GCSC_108:195051..192505 (- strand)
ATGCTGGCAGTCGCATTTTCGTCGATTCTCGCCGTTACGGCGGTGTGGGCTCAACAGCTCGACGGCTATCAGATACCATT
TGAGTCACTGGGGCTCAGCAGCGACTGTCTTGTGGCAGTCAACACGACGGTATCATCATGTCCCGCATGGCTCGGTGTCA
TCACCGGCTTGTAGGTTTCCAGCCTCGGGGCGCGCGATTTCATTCATGGAACTGATGTAGCATGAATAGAGACCCAAGCA
TACCCCTTGTGCCTGAAGCAGAGCTGAATACGCTCTGCAGCAGCACATGCCGCTCGGATATGGCAGGACTCATACCCACA
ATTCAGGCAGCCTGCACGGCGCCGACGGACGTCATGGTGCCAGACACTGTCACTGCGTATCCAGGTGAGATGATGTTCGA
GATCCAACAGCAGAAATCCTGTAGCCTGACCATTCCCAGCTACCTTCATAGCGGAACGCTACCTCTATGCCATAGACATA
TCGTGCCTAGTGGACTCGAAGACGGGCGAGTACTGCGACGTCCTGGTCAGCTCGTGGCTGAACGAGACAAACAACAATGT
GTCCGCCTACACGTCAGAGCAGAACTGCTCGTACTGCGAGCTGGCCTTGCTGCAGTACCAGCTGGCATCCCCCATCGGCT
ACGACGAAGAAAGCGCTGAAGCGTTTTCCAGTCTGACCTCCAGCTGTGCGGCGACCACGTACACGTATTCCGTGCCGACA
ATGACGACATGGGCTCTAAATGCCACCGCTGTCGCCACGACTCGGCCAACGTGTAATGCCACCGCGTACACGGTGCAGGA
GGACGACACTTGCGTCAGTATCTCGGGCGAACAAAACGTCTCCACGTACGGCCTCATCACGACAAACGCTTTGACGTTGG
CTTGCGATCCATTGCCGGATGTCGGAACGGAGCTCTGTCTGTCCAGCATGTGTACAACATACCAACTTCAGGGTTACGAC
AATTGCGATTCTGTGGTGGCAGATCTCGGCATCACAATGGCCCAATTGCTGGCATGGAACCCCAATATCAACTCCGGCTG
TTCCAATCTGGCCTACTTTCGAGGATGGTATCTGTGTGTGAGGTACATTGTTTTGTTCTGATTGATATTGATCTCCCTCC
ATTCTTCATCTCTATGTCTGCGTGTGCTGACCTAGTAGCTCTCCGTCTGGAACATTGACTGTACCATTGGGCAGCGCATC
AACGACGGCAGCCCCGGTCCCGACCAACGCCCAGCCACAGTCCAACACAGACTGCGGCCAGTGGTACTATGTAAGTCTCT
ACGTATTGTTTTCTCTGATTCTTGAGTGCTGACTGGCCAGGTTCTGCCGGGCGATTATTGCTCCCTCATTTCAGTCAAGT
TTGGCATCTCACTCAGCGACTTTTACTTCCTGAACCCACAGGTTGACTCGTCGTGCGACAACCTCTGGGCAAAAACTTCG
TACTGCGTAGCGGCAGTCGGAAACATACAGACATATACTGGCTACACAGTGACAGCAGCCGCAACCAGTTTCACCCGTCC
AGTTACATCGACTTCAACTACCCCCCCCCCTACGTCGGCCCGACACTCAACCCAACAGCGCCAGGGACCATTGAAGGATG
CTATTACTACTGGAATACTTTTGTCCCAGGTCTCTTTGTACAAGATGACGATGACATTGACATCAACTCGTGCTTGGCGT
GGACGTGGGGAGCCGAAGTGTTGCTGTCGGATCTCCTCGCCTGGAATCCCAGCCTGAATGCTAGCAACTGTTTCATGGAG
CAAGGGTACAGTTACTGTGTGCAGAAAGATGAATTCCCAGGTAGGAAAAGAGGCCAGAGAAACAAAAAAGCAAAGAAAGA
CGAGAAACAGAATGCTGACGCCAAAAACAGCCAATATTACGACAGCCAATATTACGTACCCATACGACTATTGCTTTGCA
CCGAACATCTCCTTGATTGATTCTAGATCGGTACAACCGGACGAATGTGACTGCTACATTCAGGTACGGGAAGAAGACAA
AGGTGAGACGGCAGACAGGAGATGAGGGCCAAAAACGAAGAGTATCTGGAATTAACAACAGAAACAAGGATACTTCAACT
GCAGCATGTTTCCAACACTGTTCAACATCACGGTGAACGACGTCGTTGCGCTTAATCCACAACTCACTAGCAATGTGGCA
TGCGACAGCAACCTCTGGAACGGCCTCGTGGGAGGCTACGAGCAGTTCTGTGTCGAGCGCAATACAACCGGCGTAAGCAC
AGGCACTTCTTCGTCGTCCACGTCCACCGCCACTTCGGGACAGTTCTCTACCACACCGATGGCAACAATAACAAGCACGT
CTGTGAGCACTCCATCGTCTACTACGGCCGTGGTCCCCCCCGCTCAGACAGAGCCTGGCACGACGTCCAGCTGCACCGTA
TATCACGTCGTCGTTTCTGGTGACACCTGCTATGCCATATCTACAACGTACAAAATCTCTCTCGACGAGTTTTACGGCTG
GAACCCTAATGTTGGCACCGACTGTTCGGCCCTTTGGCTAGGATATGCTGTTTGCGTAGGGGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62