GenePrediction:GLEAN_7035 Details

Name: GLEAN_7035
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:191952..190615 (- strand)
Length: 1338
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:191952..191845 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_108:191424..190615 (- strand)
Length: 810
>GLEAN_7035 class=GenePrediction position=GCSC_108:191952..190615 (- strand)
ATGCCATCTGTGTACTGCCATTACACATACTGCGAGGCTGAGGCAGTGCCGGCCGGTGAAAATGTCCTGACTGGCTTTTG
CTACAGACAGAAACATTGGTCCGCGTCTGTAAGTTCCTATTAAAATTTTCTACGACTTTTGCCTGTATAAGCGAGGTCGA
CAAGTGGTTCACTAACAGGATGTGTTAGTTATGCTAATAATCCTGACGGGAGCACCGCCTGCGATGCCTAGAAGCCGTCT
CCCGACTCTCTTTGGGTCTATACCTAAGCGCTAAATTGAAACGCCAGTTGTATAAGACGTGATGAGAGAAAGTGCAATAT
CCTCGGCACGACAGGCCCAGATGCCTGTCATAGATTCCCTTTCGCAGCCACCTCCTCGCAAATCAGGGCCACCAAACTCA
CATTCCTCCGGAGTATAGCTCGCAGCATTATAGGAGACCACACCTCCCTCGTGACCGGCGGCCGGCCAGTTGCAACTGAC
AAATCATGGAATATACTTTGCCTAAATCCACAGCTGCAACGCTGGTAGGGAGAGGCGCGGCTTGGCCTGAAATGCCTCGG
CGTGACGCCAACTCCGAACGGAAGTGCCACCGTTAGCATCCAGTTTGTCTGGATGCCTCAGCAGAAAGCCCCGCCTCGCG
GCCAGCCAAAGACATGGATACGAGAAGACGCCTGGCGGCAACCGGTCTGCATGGACGCTAGAGGGGGCGAGCATTGGGTG
GCGGACTGGCGTGAGCGACCACGATATGGCACTGCGCTGCGGCCCGGAACGGAGGACGCCAACATCCCGGGCGCAGCCAT
TCCCGTTGACCCTGGCAGCAAAGATGGGATCGTAGCAGCCGTCGATGTGCGCACCGGCCGGCCCCTACGGTCGGGTGCGA
CCTTTTCTGTCTCTCTGCCCTTGCTAGTGGACGCATACAACATGAAGGCAATGCTGGACCTTCAATGGGCGTGCATCAAC
ATTGCTTCCATGTCTGGTGCCTCCGGATCGGCTGACTTTCTGGCCGCCGACGAATTCGACGACGCCTTTAGTGAGGGCCT
TGTCGCCGCCGGGATTGTGCCGTCTCTTGGTCCGTTGGGAGTGACGAGCAAGAAGCGGCCGAAGGATCAGACGAAGCAGC
CATCTATGATTCCTAGGCCCAAGAAATCAACCCCCGCCGCTAAATCCCAGCTGGTGCTCCGCCCAAAGCTGGACCCGGCG
CACGGATCGGCCACTGCCATCGTCATTGCAGAGCAGCCAGGGGTCCCGAAGAGTATGTCCGTCACCGTAACGGAGGTTTC
CATACCCGCTGCAAAAAAGGTGCAGCTCCCATGGGTGCCGGCGCAACCGTGGAGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62