GenePrediction:GLEAN_7036 Details

Name: GLEAN_7036
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:188188..185735 (- strand)
Length: 2454
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:188188..187921 (- strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_108:187844..187475 (- strand)
Length: 370
Type: CDS
Source: GLEAN
Position: GCSC_108:187404..187094 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_108:187033..186005 (- strand)
Length: 1029
Type: CDS
Source: GLEAN
Position: GCSC_108:185910..185735 (- strand)
Length: 176
>GLEAN_7036 class=GenePrediction position=GCSC_108:188188..185735 (- strand)
ATGACACTGGTCGGCGCCGGTCCGACCGCTGAGGCCAAATTCCCGCTAACGGAGCTCGCTGACGATTTTGATACAGCCAC
AGCCACGAGATTGATGGACAGACGAGTGGCCGCCGACGGCCTCGAGGAACGCGCGCCGTGTCAAGAAAGCCAACCGGACG
GATACCGGGGCGATGTCGGCGCTTGGGGAGGGGCAGGTGAGCCAGACTGGCGGACCAGTTCGTCGCGTACCACGGCTGCC
TGCATGTCGGTCATGTCACCAGAGAAAGGTCAAGTGCGACAACAAGCGGCCCAAGTGTGCGCCGTGCACGCGCAACGGTA
CAGCCTGCATTCTGATATTTCCAGGGAGCGAGCACGAGACCGTATCGCGGGAAGAGCTGCATGAGCTGGAGCAGAAGGAG
CAGGCTCTCACCACAGGCGCCAGACAGACAGCAGTTGCGGAAGAGGAGGGCAGTCGGGAGAGGTCGCCAATCTGGCACGA
CCCACCGCCAGCCAGCACAGCAGTCCATGCGATCAGCACAACAGCGCCAGCCGGCAAGACCGACACGGCGTCTGGGTCCG
GGTCCGGGTCCGGACTCACAGAATGGCGGAAAAGCCAGGCCCATCTGATGCAGACACTCGGACGGACAGCCAAGGCAGCC
GAGGCAGCCGAGGCACACGTCGAGGCCAGCGCGATGCCGTCGGCCAAGGATGTGCACTATCTGTTTGAGAAGTAGTGAGT
ATCACGACCGGTGTTGGGGAAGACAGAGACTGCCAACAAGTGCTGAACAAAGGCTTCTGCACAGCCTCATGGGATCCCAC
GTGCAGAACCCATTCCTGCTCCGGCACGAGGTCGAGCAGCTGTACGTGCGGGTCTTCTCGGCCAGCGAGAGCGGCGATGC
TGTGGGCCAGGCGACGTCGCAGGACATCTTCCGCACGTTTATGATCCTGGCCATCGCGACCGTTGTGCCGTACCGTTTGG
GCGAGCACCCGCACCACCCGTTGGGCTACTATCTGGCGGCAATGCCGCACTTTGGATCGGACTTTCTAGCGACGAAGCTA
GAGTCGGTGCAGGACCTGCTGCTGATCTGTCGGTTTGGGATATTCTACCATATAGGTCGGTAGAGGGGAGTTTGGATGGA
TATCGTCATTGTTGAGCCCGGCTGACCTGGTGCAGGAACGTCCATCTGGGACACGATCCAGCTGTGTGGCCGGCTCTGCA
TCGAGCTGGGCCTGCACCGGCCGCGGGAGAGGCCGGCGGCAGACATGCTGCAGGAGCAGATCGAGCGGCGGGTGTTCTGG
GAGTACTACATGCTGGACCGGTACAGCTCGACGACGATCAGCCGACCGTTTGCGCTGGCGGACCGGGACATCACGGTGCC
GTTCTGTGCGGACGCAGACGACGAGGAGATCCGACAGGCCGGCGCAGCCCAGCACCACGGCCACCGTCTCGACCTCGACA
CGTTCTGCCGGACGCGCACAGCCTCGGGGCCGACAGAGATGAGCGTCTTTTTGCTGTGCGTGCGGCTGCGGCAGATCTCA
TCGCGCATCCAGACCGAGTTCTCCCAGCTCGTCTCGGGCTCGTCGGCAGCCATGGGCAGCGGTCCGACCGCACCGCCAGC
CTTTCTGCTGACCGGCCGCATCTACGCCCTGCTGGACGACATCCTGCGGGCGATTGACGAGTGGCGTCGTGGCGCGCCCG
TCTTTGCCGCACCGCGCGTCCTCTACGAGATGTCCGAGTGGTACGACCTGCTGCTGGCTCGCGAGCGGTTGCACGCCGTC
CGCAAGGCCATGGACTTGGCTCCGAAGCACGACGACGGTGGTAGCGGTGGTGGCCTGCCGGCTCGTCACCTGCTGGCCCT
CTGCCTCGATGCCGCCACCAACACCATCCGGCTCTACGGCGGCCTCTTCCACAGCCACGTGGTGACCTACACCCGCTCCT
ACTTCCACACCGTCTTCACCGCCGGCCTGTCCGTCATGTTCTGCTGCTGCGCTTCCTCGCCCGCTCAGCGACAGCGACAA
AACCGCGACCGGGACCCAGACCGGGATCGTGCCGATGACTACGATCACTCCCGCGAGCGCATCCGTCAAGCCCGCTCCGT
CCTCGTCCTCTGCGAGCAAACCCTGGCCCACATGGGCGCCCAGCTGCCCGATGCCCGCGGCTATGTCACCGCCTTTGAGG
CCCTGCACAAGAGCGTCTCCCTTCGTCTGGACCAGGCCCTGCAGGCCGACGACGAGGACGACGTCGACGACGTCGACGAT
AGCCAATACCCTCTCGATCATAGCCGCCCCGGCAACAGCTATCAAACTGATCGTCCCCGCAGGCGTCTCTCGCCCGGCCG
CTCGGCACACGTCCAGGACCCGGCCTTGTGGGACGTCGCAGCCGCCGCCAGCAACGCCAGCAACGCCAACGTCGGCACCC
TCGCGGCCTTGTCGCCTTCGACTTCCTCTGTCATGGCTGCTGCCGCCTCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62