GenePrediction:GLEAN_7038 Details

Name: GLEAN_7038
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:182862..179539 (- strand)
Length: 3324
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:182862..182737 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_108:182649..182447 (- strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_108:182262..182235 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_108:180228..179539 (- strand)
Length: 690
>GLEAN_7038 class=GenePrediction position=GCSC_108:182862..179539 (- strand)
ATGTCGTCTCCTCTTGCCACAACTGCATCTCCTCTGCCGACGTCCATTGAAGAACTAGGAATAGTTCCTGCAGCGCTGCT
TCAAGTTAATGTTCTTCCTGGCTCCCACTGGGCAGAGATAGGAGCAGTAAGGCTTCATTTCCCCTCATTTCCCCCTCTAC
TCCTATGCGAAAAAGGGAAAACAACAGCAATTCGAACGTAGCTGACATAACAGAATGCCGACGCCAGTGATGCCAACGAC
AATGACGCCGAATCCGAATCTACCCTGAGTGCAGATGCTGCGTCCTCCACCGCCTCCCTAGCATCGTCTATCCTTGCATA
TCGCCAAATCCATGGCCGCACCTATCACAGCGAACGTGGAAACGCGCTGTACTGGGGATCTAATGATCAGAAAGCAAATG
ACTCACTTGATCTTATGTATGATCCTGACTTTGGGTGGTACGGCGTCTTATCTGGTCGTGACTGATAACATTGTAGCCAT
CACGCTTTTCTACTTGCGTTCGATGATGAACTGTTACTGGCGCCGCTTGAAAATCCAAAGGTGGCAATGATTACTTCTTT
TCTCTGAATATTGGCAGCCGGCATATCTAATACTTCCCAGAAAGTCTTGGATGTTGGCACGGGGACCGGTACGTGTGATT
GGGTGATAGAGACAGGACAAGACAACTAACACAACTTGTCTCTAGGATTTTGGGCTATGTGAGTATCCGTGGTTTGCCCG
GATTGCAACGCATTTGCGTAGAACACGCTGATAATGCTATAGGGACTTCGCCGATGCGTATCCCGGCTGTGAAGTGATTG
GGACCGACGTCTCACCCATACAGCCTATATGGGTGCCACCCAATTTGTCTTTGTAGGTACCACCTTTATAAATACAACAC
AGGTCCACAACTCTGCTTACAGCTTGTAGCGAAATAGAAGATTACACAGGCCCTTGGACTTTCACACCTGAGAGCTTTGA
TTATGTGCACGCGCGGTACCTTGGTGGAACTATCGTCGACTGGACTGCCTTTTTCAAGGAGGCATATCAAGTCCTTAGGC
CTGGTGCGTGGATTGAGAGCTACGAGCCGTCCGCCGTCCTGTATTCAGACGACGACAGCATCCCGCCCACATCAGCCATG
GCCCAATGGGGTCTACTATTTTGGAAGGGTAGTGAGAAAACTGGCCGGTCCTCTCGAATATACGAGGATGGGGTACAGAT
GTCGGCTCTGAAAGCTACTGGATTCGTCGATTTGCACGAGAAGACTATCAAGGTAAATCTTACCCAAATGTCTTTAGAAT
CACTACTAATCAACTACGTTGCGCTTCAAAAGCTTCCGATAGGTGCGTGGCCACAAGACCCCAAACAGCATCAGATAGGC
CTCCTTGTTATGGCAGCGATTCTGAACGATGCTGGCGGCTTTATCCTGTTTATGACTGGAGTCCTTGGCTGGTCCCCCGA
AGAGGTCACTGTGCTCGTATCCCAAATGCGAAAAATGATTCGTGATACTAAGTATCACGGGTACTATTGGGGTCGAGTGG
TATATGCGAGAAAGCCGTTTCCAGGTGAAGTTGGTAAAGTGGCTTGATTGCGAGTTGGATGAGCATGGTCGTATGTATCG
TGACGGACATAGCCAAGGCTAATCTAGATGCTCCGTCTGGAAATGAGAGGACTTTTTGAGACTGTCTACGACCGTTGACA
GTTCATTTATAATTGTAAGAAAGCAAAGTGAGATATACGAAGTAGTGTATTAAAATGGGACTGCCAAAGTAAGACATGGA
AGGCAGGCATAAGTAAAGGAAAGTCGATTCTCTAGTTGATGCTTGTACTTGTTGGGGGAGACTCAAATATTATGAAAAAG
TTGTGGTTGTACTCCGTCCCGTATGAGAAATCGGGTAGATGGATGTCCCTGGTTAGGGAGACAGATGCATCAAGCCATCC
AAGTGTAACGCCTCTTTGGGGTTAACGACGGCACCATGATCGCAATATTTACCACCGCCTGTAGCTACATCTTGACAAGA
TGCAACAAAAGAGGCTAGATCAAGCAAGCTAAGCTGAGCTTAAACCGCACTAATTCTTCCCTGCAGCGGGTCTTACGGCA
TCTAGCTTGGGGTTACAGACAAGGAGTAGGTTTGGGCCAAGGCTTCCCTCGACAGAAGTAAAAAAAGCCATAGTATTCGC
CCAGAAGGAGATCTGTGCCAACAGTAGCGTAATCAGCTAAGGATGTCTCTATTAGGTAACGCGCGAGCAGCCCCAAATAC
CACATAAACGTGTGGGCCTTTAAACTGATTGCTCGTACACTTATAAAACAACACTGTGTCGACCAATCTAGACTGATAGT
CTCTAAACTGTGCGGCAGTGTTTGCACGAACACGCCGAAGTTGAGCGCTGATGAATCTACGTCGTCGTGATTTGCTTTGT
GCTGGCTCGTTTGGTGGACTAGGGCTACCTTTGGCCCGAATAAAGCGGGGCCGGCATGAGTCAACGGCGTCGAAACTTAT
CCGGCGTCCGGACCGAAAAATAGATCAGCATTTAACGGTTGAAGCTGGATCTTTTTTTGGTCGCTCTTCGAACCAACGGT
CCTGCAACCTGTGACGAATAGCAACAATGGCGGCGCCTCAAATCAGACTCCTTTGTCTTCACGGATTTCTCCAGAATGCC
AAGGTGTTCTCCGAAAAGTCCTCTGGGCTGAGAAAGCTCCTGAAGAAGTCCAACATCTACATGGAATATATTGATGGCCC
TGTTGTACTAGAGAAAAAGGACTTGCCATTTGAGGTCGACGATGCGAAGTGGGCAGAGATTGCCGATAGTGGTGTCAACA
GGGCCTGGTTCTACCACGACAATGTCTCCAAGAAGCTCGATTTACAACTGGCCCTCGCATCGGTTGTGAAGCACATCAAG
GAGAACGGCCCATACGCCGGCATCGTCGGTTTCTCTCAAGGTGCGGCTGTCTCCACCATCATTGCGAACACGATCAAGTC
CTACCCGGAACTCTCCGGCGTCCAGGACTACTTCAAGCTCTCTCTCGCCGTATCCGGTTACTCGTTCACGGAGCCAAAGC
CAGATGGCGCCGAAGGCGAGCTTCAGATCACAGAGAAATTCGTGAGCGCCTTTACCGTGCCCGTTGACGACCCGGCCTAC
GTCACCAAGTCCGTCTTCATATACGGGTCCAACGACAACTCTGTGCCTGGCGTCAGATCGCAGTACCTTGCAGCCATGTA
CCCAGAGGATAAGAAGGCTGCTTTCCAACACGACGGCGGTCACTTCGTGCCCAACAAGAAAGACTTTTTGAATCCCGTGG
TGGACGAGATCCTTATTGCCGTTGGTCTTAAAGAGTCTAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62