GenePrediction:GLEAN_7039 Details

Name: GLEAN_7039
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:176938..174144 (- strand)
Length: 2795
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:176938..176809 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_108:176749..176628 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_108:176566..175389 (- strand)
Length: 1178
Type: CDS
Source: GLEAN
Position: GCSC_108:175329..175269 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_108:175192..174500 (- strand)
Length: 693
Type: CDS
Source: GLEAN
Position: GCSC_108:174392..174276 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_108:174212..174144 (- strand)
Length: 69
>GLEAN_7039 class=GenePrediction position=GCSC_108:176938..174144 (- strand)
ATGGCCCCCAGCGCAGACGACGCCGGCAGGACGGCGTCTTCGTCGGACGACACGACACCTCGGCCGACAGCCGCTCCGGC
CATGGGCCACCAGGCGTGCGAGCGGTGCTGGAAGCGAAAGCAAAAGGCAAGTGCACGTGCACGTGACAGCCCTGGAAAGA
CGTTCTCACGGCCCGGCTGACCGACACAGTGCGACCGCCAACTGCCGTCCTGCTCGACGTGTGCCGGTCTGGGCGTGACC
TGTCAGGCGAGGAGCGTACAGTTCGACTTGCTGACCGACGACAGTCCGCTGTCGCACGCCTCGACCCTGAGGTGGGTTTC
CCGTCTTCGTTGGGGGGTGTTCCTTTTCCGCTGACTACTCAGCTATGTGAAGACGCTAAAGCGCCGACTGGACGAGCTGG
CCCACGCACCACCACACGGCCAGAACAAGCGAGCCCGGCTGGACGGCGACCGGCCTCGCAGTGACGGTGTCGCCGTCGCC
GTGTCGTCCTTTTCGTCGCCACCGTCGCCGTCTGCGCCGGCGCCACCGCTTATTCGGACTGCTGTCACCACCACTCCGTC
CACAGTGCGGATTCGCACGGCCGCATCCGAAGCCGGCACCAGCAGCACACGTCTCCGGGCTCATGCCAGCACGAGCACGG
CCGCGACGTCGCTGGCCGCCGACGATGAGGTCGCTGCCGATGCTACGGACGGATCCATACGCGCCATGATGGGCGAGATC
GGCTTCCTGTCGCGCAGCGCCATCGGAGAGCCGCACGACGATGAGCCAACGACGGCCGTCCAGCGACCACTTCGTCTGGC
GCCTGACCGCGTCGTCATGGCCGCCCTGGCCCTCGACGGCCACGATCCCTCGGGCAGCGGACGTGATGGAGGTTCTGCTG
CTGCTGCTGCTGCTGCTACCGGCGACAGCAAGAACGGCTCAGCCCCTCTGCATCTGCATCCGCATCTGACAGACCCTCCC
GACGATTGGACCTGGACCTTGACCAGACTCGCTTCGGCCGTTCATCTGCGCCGCTTTCTCGACGAGGTCGCCGTTCGGTT
CCCCCATCTGGCCACGGCCAAGGCCGCTGACCAGCTCGAGGCCCAGTACGAGGCCGTGCTCAAGGCCCAACACGATGCCG
TCCTCCAGTCGCAGTCCTCTTCCTCCTTCTTTTCGTCCTCGTCGGCCCCCTCGCCATCCGCTCGCCTGGCTGTCTACCTC
GCCGTCGCTACCGGCGCCCTGCTGGCCCCTAATGCTGCTCGCCTGCACGGCTTCGCCCAGCGCCTTCACGCTGCCGCCGT
CCGGCTGCTGCCCGCTGTTCTCGTTCAGCGCCCTGGAGCGTCTGCTGCTGGAAACTCCAACGCGGGCGAGGCGCTTGCTG
CCATCCGCGCCATCGTCGCGCTCGTCATCTACGCCACCCTCTCGCCTGACGGCGGCTCGGCCTGGCATCTGCTCGGCATG
GCCACCAAGCGCTGCATCGTGCTGGGATTGCGACGCGAACCTGACGTCCAGTCGGCTGTCGAGGCCGATGAGCGGCGTCG
CCTCTTCTGGAGCGTCTACCTGCTGGACCGGTGAGTTGACTGTTGACTTCCTTGGGTCTGGTCCTTTGGTCCGCCTGCTA
ATCTGGTAGGTCTATTGGTCTGGTTATGGATCGCCCTTTTAGCATCCAGGACGAAGATATTTCTGTCAGCGTGCGTATCT
GTTCCTCCTCTTCTCTCCTCTCTCCTCTCTCCTCTCTTCTCCTTTCTCACCCCTTCTCATCCACAGATGCCAGAAGATGA
CTCTTCCTCCCGCGAAATCCCACCCTTCTTCTCCCTCAGCCACCACCTCGTCGTCCAGGCCCGTCTCGTCTCCGCCGTTC
GCACAGCCGCCCGCACTGCTCCCCTCTTCGACTACAGCAACTTTTGCTACTGGCGCGACTTTCCCCCTCCGCTCGACCAT
CTGCCTGCAGACGCCCGCGAAACCCACGCCGACTTCCTGCACCTGCTGGCCTGCCGCACCCTCGTGCAGATCACCGCCAA
CTGCCTGCATGGTCACGAGCCTGCTGCCTCTTCCACCACTGTCACTGCCACCATCACCACCACAACCGAGACAAAAGCCA
TCACCGTCGACGCCTCCGACTCTTCGCCCTCTGTCCTCTCCTCGTCCTCTTCGGTTGCCGCTTCTTCGGCCTCTACCTCC
ACCCCCCATTCGCCCAAGGAGGAGGACCCCGGCACAGCCCAAACGATGGCGCCTGTCGAAGCTGAAGCTGCCACCACCAC
CGCGCCGCCTCCTCTCGCCCCCAGCGTCAGTGTCGGCCTCCTGTCCGGCCAGAGCCTTCGCCAGAGCATCGACGACGACG
CCGCCCGCCACTGCCGCGGCCTCATCGAGCGCGCCTACGCCCGTGCCGACCGCGAGCTTGTTTTGTCGGCTCCTTTGTCG
ACGCCTACGACCTTTTTGCCGCCGGTGTCGTTTACCTCTGTCTGGCTTCCCGCAGACACAGCAACCACCATCACCACCAC
CACCACCCTCACCACTCCCGCCACGACCCCCAGAGCCTGCTCGAAACCACTGACCTGCTCAACAAGTGCACCATGCTGAT
CACCTCCATCGGCGAGCGCTTCTCCGCCCTCAAGCCCCTGCGCCGCGTCTTGGTCGCTCTGCTGGCCCGTCTCCGTGCCC
GCAAAATGGCCCACGGCAGCATCGTACGTCCTCTCTTTGTGCTTTGTCCTTTCTTGCGTCTCCTGTCCCCTGCTAACACG
GCCCAGCCCGAACTCGACACTCTTCCCGCCATTGTTCCCACATACCTTAAACGAATGATACACAACTGCTTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62