GenePrediction:GLEAN_703 Details

Name: GLEAN_703
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1535387..1536802 (+ strand)
Length: 1416
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1535387..1535992 (+ strand)
Length: 606
Type: CDS
Source: GLEAN
Position: GCSC_97:1536326..1536802 (+ strand)
Length: 477
>GLEAN_703 class=GenePrediction position=GCSC_97:1535387..1536802 (+ strand)
ATGGCGAGCGCGGCCAAGTCGCGCTGGGCGGACGCGGACGAAGACGCGGCCCTGGAGGCACAGCGACGACGAGAGAAGGA
GGCGAAGCGGCGGGCGCGAGCGGCGGAGCGAGCGCTGAAACAAGAGGAAGCGGTCGACAGCGGGGACGGACGGCGGTCGA
AGCGACGGAGGACGACGACGGACGACACAGGGGGATCGCCCCCCCACGAACAGACAACGGGCGACGGCCTGCTGCGTCTC
GCGGGTGGCACGCTGACCGAACCGTGCGGCTCGGTCGAGGCCTACGAGAAGCTCAACGACATCGAGGAGGGCGCGTACGG
CTGGGTGGCACGAGCACGCCACGCGGCCTCGGGCGAGGTGGTGGCACTCAAGCGGCTCAAGCTGGACGCGGCCGATCGCG
GCGGATTGCCGGTGACGGGTCTGCGTGAGATCCAGCTGCTGCGAGACTGCACACAGGAGAACATTGTCCGTCTACGGGCG
GTCGTGGTGGGCGAGGGGGGGAACGACGCGGAACAGCAACAGCCCATCTTTCTCGTCCTCGACTTTGTCGAGCATGACCT
CCGGACCATCCTCGAAGACATGCCGCAGCCGTTTTTGGCCTCCGAGGTGAAGACACTGCTGCGACAGCTCGCGGCTGGCG
TCGCCTACCTGCACGACCACTCGATCCTCCACCGCGACCTCAAGACGTCCAACCTGCTGCTCAACAACCGCGGCCGCCTG
AAGATTGCCGACTTTGGCATGGCCCGGTACTGGGACGAGGAGGCATCCTCGACTTCCACCTCTTCCTCCTCCTCCCCCTC
CCTCACCTCCCTCGTCGTCACCCTCTGGTACCGCGCCCCGGAACTGCTTCTCGGCACCCGCCGCTATGGCCGGCCCGTCG
ACATGTGGAGCGTCGGCTGCATCTTTGGCGAGCTGCTCATCCGTGAACCCCTGCTGCAGGGCCGCAACGAGGCCGATCAG
CTGGTCCGCATCTTCGACCTCTGCGGTCTGCCTACCGACACTTCCTGGCCTGGCTTCCGCCGCCTGCCCAACGCTCGCGC
CCTGAAGCTGCCCCCATCCACTGCAGCTGCAAGCACCTCTTCCTTTCGCTCTCGCTTTCCCCTTCTCACTACCGCTGGCT
GCCAGCTGCTCGGCAGCCTTCTCGCCCTCGATCCCGCCCGTCGTCCGTCGGCTCGCCAGATGCTCGACCATGACTACTTC
CGCCAGGACCCTCGTGCCAAGCCAGAGGCCATGTTCCCGACCTTCCCCAGCAAGGCCGGCCAGGAACGCCGCCGCCGCCG
CAATACCCCCAATGCCCCCGTCCGTGGCGCCCTGGCTGCCACCGACCTCGACCTCGGTGCCGTCGATTTTGCCGGCATCT
TTGCTGCCCGCGACAAGGAGGAACGCGGCGCCGGCTTCTCCCTGCGCATGGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62