GenePrediction:GLEAN_7041 Details

Name: GLEAN_7041
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:163358..162085 (- strand)
Length: 1274
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:163358..163169 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_108:163100..162829 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_108:162765..162085 (- strand)
Length: 681
>GLEAN_7041 class=GenePrediction position=GCSC_108:163358..162085 (- strand)
ATGCCGACGACAACCGCCGAAACGCTGTCGATTGTGACGCGGAATGTCACTGTTGCGCCACTGGTGCTGCTCTCGGCGGT
GGACCACTTCAACCGCAGTGCGGCGACCAAGACACGAAACAAGCGGGTGGTGGGCGTGTTGCTAGGGCAGAACGATGGAA
AGATTGTGCGGGTATCGAACAGCTTTGCAGGTGAGGACTGGCCGTGGACATCTGGCTTTTGGTATTGTGCTGGGGACAGG
AGCTGACAGGCGAGCCAGTGCCGTTTGAGGAGGACGAGAGGGACCCATCGGTGTGGTACCTGGACCACAACTACATTGAG
GCGATGAACGACATGTTCAAGAAGATCAATGCGCGCGAGAAGCTGATAGGGTGGTACCACTCGGGACCGAAGCTGCGGGC
ATCGGACCTGGAGATCAACGAGCTGTTCAAGCGGTACACGCCGCACCCGCTGCTGGTGATTATTGACGTCCAGCCGAAGG
AGTCGGGCGTGCCGACAGACGCATACTTTGCCGTGGAGGAGATCAAGGATGTATGTTTTGGAGCGCCGGCACAGTCTATA
TGTGCTTCCCCCCCCCTCAAACAGTACTGACAGACGCAGGACGGCACGACGACATCCAAGACGTTTGTGCACACGCCGTC
GATCATCGAGGCGGAGGAGGCGGAGGAGATTGGAGTGGAGCACCTGCTGCGCGACATCCGCGACGTGGCCGTGGGCACGC
TGTCGACGCGGGTAACCAACCAGCTGCAGTCGCTGCAGGGCCTGCATCACCGGCTGGGCGACATCCAGGCGTACCTGACG
AAGGTGCTGGACGGCCAGCTGCCGGTCAACCACGCGATCCTGGGCAACCTGCAGGACGTCTTCAACCTGCTGCCGAACCT
GTCGACGCCGACGAGCGGGGCAGCCGGCCAGACGGGCCAGCCAGCGTCAGGGCAGAACGGCACGTCGGCGCCGCCGGTCA
AGGGTGATGGCGACCTGGCGTACGCGATGAGCGTCAAAACCAACGACCAGCTGATGGCCATCTATCTCAGCAGTCTGATC
CGGGCAATCACTGCCTTCCACGACCTCATCGAGAATAAGATCCAGAACCGACAGCAGCAGGAGGAGAAGGACGCGGCCAA
GAAGGACGGCGAGAACGGCTCGGCAGTAACGTCAGCAGCAGGCGGCGGCAAGGACAAGGACGGCGCAGAGAAGAAGGACG
GTGGCGACGCCAGCAGCGACAAGAAAGACGGCGGCGATAAGGCGCCGAACGGGACGGCCAAGGAGAAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62