GenePrediction:GLEAN_7043 Details

Name: GLEAN_7043
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:143437..141942 (- strand)
Length: 1496
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:143437..143179 (- strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_108:142908..142737 (- strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_108:142475..142366 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_108:142306..141942 (- strand)
Length: 365
>GLEAN_7043 class=GenePrediction position=GCSC_108:143437..141942 (- strand)
ATGTCGACCCGACCTCGCCGGTCGGCCGCCCAGCGGGCTTCTATGGCCATTACTGACATGGCCGACAGAGATTCTGCCAT
GACGTCCCGATACCGGCGTCTAGGCGAGGGCCGTGGCTCCGGCCGTGCGCCCTCAGCCGACTCCAACATGTCCTCGGTGC
TCGCGTCCGGGTCGAGGAAGCGCCAGAGTGGCGCGGCCAGCAGTCTGCGCGAGCAGTCCGTGAGCGATGGTGTCGTGCAC
AGCCGTCGGCCGACGCGCGGTCCGAAGAAGCGATACGTGGAGTCGGAGTCGAGCGAAGATGAGGACGAGGTGGTGGTGGA
CGAGGAGGACGACGACGACGATGACGACGACGACGACGACGAAGAGGACGAAGAGGAGGAGGAGGAGGAGCAGGACGAGA
TCAAGGTGGGCGACAGCGACATTGACATGGAGGCCGACGAGGACGCCGAGGGCGAGGGCGAGGACATGGATGTCGATGCT
GACGGCGATGTCGATGTGGACGTGTCCACCGTGTCGGCTGCCGTCCGAGGGGTCGCTCGAGGGGGTGCTGTGCCGCCGCC
GTCGATCAAGGTATCGAAGCCGGCCGGCGAGGGAGCGTCTGTGGTGACGGCACCGCGTGGCGTTGGTCGGCCGCCCGGCA
GTGGCAACAAGCTGCGGGCACCGTTGACGTCCAAGCCCGGGCCCAAGTCCAAGGTGCGGCGGTCTGCTGCTGCCGGGGTC
CGGAGCAAGGGCGTGCCTCGTGAGGAGGACGAGGAGGACGAGGAGGACGACGAAGACGACGCAGACGGTGACGAGGACGA
TGAGATCGATGCCGAGGGCGAGACGGAGCTGGTCGTCGAAGACGAGGACGACGAGGTCGACGCCGAGGGCGAGGAGATTG
AGGTGATGGACGAGGACGACGAGGACGATGTGGAGGGCGATGGAGAGGGCGACGGAGAGGGCGACGGGGACGCCGGTCTC
AGCGACGGCGAGGGTGGCAGTCGCGAAGGCACGCCTGACCTGTCGAAGATGACGCGGCGGCAGCGGGCCCGCTTCGAGGA
GACGCCGCAGGAGTACATGAAGCTGTCGGACGGTGAGTTTGTTGTGGTTGTGGCGCGGTTGTGGTTGTACGTGCGGGACT
GACAGAAACAGAGGTCCAAGTCAAGAAGCACTTCACGGCCGAGGAGCTTAGCATGCGGCGGGCCGAGATGGCGCGGCGAC
GACGCAACCTGAGCGAGAAGCGGAACGAGGAGGTCAAGGCCGAGACGATCAACAAGCTGCTGAAGCGACAGGCGCCCAAG
ACGACCAAGAAGAACGCGCTGGCCGGCGACGACTCGGGCGACGAGGACGGCCGGCCACGACCAGACCCAACCATCATTCG
CTGGGTGAGCAATAGCAAGGGCAGCCGCGTGGCCGTGGCGGCCGAGCTGCTGGCCGGGCCTGTGGGCAGCGTGTTCCGGA
CATTGGGCAGCGCGATGCCGCCGCGGAAGGTCCAGCTGGTCGAGGAGGTGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62