GenePrediction:GLEAN_7044 Details

Name: GLEAN_7044
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:141427..138564 (- strand)
Length: 2864
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:141427..141235 (- strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_108:140649..139797 (- strand)
Length: 853
Type: CDS
Source: GLEAN
Position: GCSC_108:139731..138564 (- strand)
Length: 1168
>GLEAN_7044 class=GenePrediction position=GCSC_108:141427..138564 (- strand)
ATGCAATTTTTGGAATCCGCAACGGCATCGACGAGCAACGAAGAGGGCGAATCCTGGTTACTACAAAGTACAGAGTATAC
CTTCTCGACCGGCCGCGCTCGTTTCCGCTCCGCACGACCTCTCGCCGCCGCCCTGTCCACCATGGCCGACATGCCCGTGC
AGTCTGGTCCTCCGGTCGGCTCCACCGTCGATGGTGAGTCTGGTCGAGGCAGAAGAAGCCTTTTCTGCTCGCAGGCCTTT
TACGTCTTTACGTCATTTCGCTGGCTGCTTTCTTTGTCATTCTTGCCGTTTTTTCTTTTTTCTTTCTTTTTTTTTTTTCA
TGCCCTGTACTCCGTATCCCATTCTCTATTGTGTGCCTGGTCAGAATCTGGTACGAAGTCTGTACGAGTATTTGTACCTC
AATCATTGCCACCCTTGCATCGGTCATCTTGTTCATCCCCTCTTCTCTCCCTCTCGTCCAACCTCGCTGCGGCCATCTCC
ACCCAGTCACTGCAGGACCAGGTCATGCATGCATCAGGCAGACTAGTTGCATTGATTGGCCTGCTCGCCTGTTCTGCTGT
CTTTTGATCGCACCCAACATACGACCCCATACTTTGCCCGTCTTTGCATGTTCGTATTCGCCCTTCTTCTCCGCGTCTTG
TCCGTCGTCTCATCCTGGTTTTTCCACTCGCTCCGGCCGTTCATCTCCTTGTCTTCGCTCTCGTCCTCTTCCTACATCCC
GATTGCCCTAGTATCTGCTTCCCCGTCTCCTGCTGCTCATGTTATCCATATTTCTCAGCCACTGCTCCTGCTGACTTCAT
AGCCGCCATCACACCACTCTCCGCCCGCTGTCTGTCACTGGACCAGCCTAGTGCACGGGCCCCAGAATCCACGCCAACAT
CCGTTCCAGCACCAGTCCAGAACCTGCATCTCCACCCCGCAGAAGCACTAGTGCCGCTTCGTTCTGATCCTGATCCACTC
CTTTGCCCGGCAGTAGAGACACCAGCACCAGCAACAGCAGCATCGCCAACACCAATAAAAGAGTCACCGCCCCCAATCGT
CTCGACCGCTGCCGACCCTCCCTCCCACCACAGCCATCCGCAGCCTGCCGCTGAACCCATTCCCAAAATGATTTTTTCCG
ACCTCTACAAGTCACCGAGGTCGCCCTTTTCCAAGCTGCTTCAAACCACGTCCCATTCGAGCGATTCGGACCAGCAGCTG
TCCCCGACCACATCCCATCCTCACCTCACCGGCGCTGCCCTGGCTGCCCAGCTCGACTATGGCGACGCCGATCTCGTCAG
CCCGAACAAGGCCAAGCAGAAAGATGCCGTGCGTCGCTTCCTGATGGCCAACATCCGCAACGACTGGTCCTTTGACTGGC
CTTCACAGACGACAGCCACGGCTGCTGCCGAGGCTGCGCGTGCACGTGAGCTCGAGGCCGCCCAGCAGACAGAGGAGTCG
TCTGCCGAGCCTCTCGAACCGCCATCGCCGCCATCGCCCGTCGTCTCGGTGCCCCTGGCTGCTATCACGGCGAGCATGAA
CAGCGCGTCCTTTGACTCGGACTCGGACCTGGACGCGGCCGACGACTCTGACTGCGCGTCTGTCTACAGCACCGTCTCGG
AGGATCCGCTGCACCTGCAGCCACGGGCCGAGTGGACGTCCGACCTGTCGGACAACGAGAAGAGCGCGCAGACAACAGCA
GCTGCAGCAAAAACAGCGACGGGCGAAGCATCAGCCACACCGGCTCGCTCTTCCGCTTCGACTCGCCCGACTCGGTCGGC
ATGGTGGTGCAGGCATCGGTCGTGGCCCGCCGCGCCAAGATGCGTCGCAGCCTGCGGTCTGAGATGGCCTGGAACAGCGG
CCTGGCCTGCTTCACGGCGCGTCGCGATGCCTGGACCGGTGCCCACACGGTGCGCATCAAGTCGCGGGTCGTGGCAACCG
CCGCAGCCTCGACGTCGCCGCGCCGCCTGTTCCGCTTCCACTCGCACGCCAAGTCCGAGCCAGCGCCGGCCGTGACGACG
ATGCCGCTCTCGCCGATGACGTCCAACTCGCAGCACTCGCAGAAGTCGCAGCAGTCGGCCGGTCTCGGCCTCGGCCTCGG
TGCAGACACGGTGGAGACGTCTCCGGTGACGTCGGACGGCGGTGTCGGTGTGGGTGGCAGTAGCATGTGGCCGCTCAGCC
AGGTGCCGACGCAGGCGACGACGAGCGGACAGTCGCGGCGGTCCACGAAACGGCACCGCCACCAGCACCAGCACCGGCAG
AGCCAGCAAGACTGCGTTGTCGAGACGATGCTGCCGCTGGCGCGGCCGCTGTTGCCGGCGGCCAACCCGATGCGTGCATC
GATCACGCCGAACCTCTACCTCAGCCTGTACGACAAGGTCGTGCTGAGCTCGCTGCAGCCGTCGTGTCCGATCAACCTGG
GCGACGCCGTGCGGGCCTGCGTGGCCGGCTGGAAGCGCGACGGCGAGTGGCCACCACGCATGGCCGAGCCGGCGCTGTCG
CCCTCGGCGGTCGCAGCAGCCGCTGCTGTGGCGGCTGCTGCCCGCAAGAGACAGCGCCGTGAAGAGGCCGCCGCCCGCAA
GATACGCGATAAGGAGCGCCGCCACAGCAGCAGCCTGTCGTCGCCTGGGTTCGGCCGCCGCATGAGCCATCTGCTCAGCG
GCGGCGGCCGGCCCGCCGCTGCCAGCCTCACGACCAACACGGCAGCCGCCAACAGCACCCACAACGCACACGGCGACGCG
GCACCTCCGCCCGCCTCGCCCTCCTCCGACCCCAACGCGGACGACAGCGCCGGTCGCAGCATCCGGCGCAGCCTGCAGCG
CGTGCTCGGCCTGCACCCTCACCAGCACGCAGCAACAGGCGACACGGCCACGGCCAAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62