GenePrediction:GLEAN_7045 Details

Name: GLEAN_7045
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:137998..134864 (- strand)
Length: 3135
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:137998..137673 (- strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_108:137588..135908 (- strand)
Length: 1681
Type: CDS
Source: GLEAN
Position: GCSC_108:135854..135077 (- strand)
Length: 778
Type: CDS
Source: GLEAN
Position: GCSC_108:135006..134864 (- strand)
Length: 143
>GLEAN_7045 class=GenePrediction position=GCSC_108:137998..134864 (- strand)
ATGCTGCACGACCGCGACAGCCAGCCATTGACCCCAGCAGTTGAGCAAGCCCGGTTCGCTTCTGCTACAGAAGCCTCCTT
TCCAACGCATCCACCACCACCACCACCACCACCACCGCTATCGACTTCCGCCCCCACCGATACTGATCCCGGCATCGAGC
TTGTCCCTCTCCGATCGCACCGCGTCGACAAACAAGCGCACCGCCGCGCCGAGAAGCGCAGGTGGCTGCAGGCGCAGGAC
GAGATGAAGTTCTCCCACAGCCTCCAGTTCAACGCTGTGCCGGACTGGAGCAGCCACTATATTGCCTACAGCAATTTGAA
GAAGCTGTAAGCCGACTCCTTCCCCTCGTTTCCTCGTTTCCCTCGTTTCCCGTCTCTTCGCCCGCCCTAGGCTGACTCTC
CTTTGTGCAGCATATACCAGCTTGAAAAGACCGTCAACCAGGCTGCCAGCCACCAGGACCATGGCGATGCCGAGTCGCGT
CCGCTCATCAGCAACGAGCCAAACCCCGAGGCAGTCTTCTCGCGCGCCCTCGACGTCGAGCTCGAGAAAATATGCTCCTT
CTATGTGCTTAAGGAGCGCGAGCTGCTGGATGAGGTCGACATGGTGCTGCACGACGTCGGCGCTCTGAGCGAGGAAGAGG
AGGTGCTAGAGTGTCGCAAGAACGGCAGCCCGGTGACAGTGCCGTCCGTCACCACCACCGCTGCTGCTTCAGCGGCCGGG
CCTAGCAATGCCGGCAGCACGATCGCAGTCGACGACCGGTCCAGCACCCGCCACTCTAGCGACGACGGTGACAGTGACGA
CGATCACCAGCCGCTACCACCGCTCAAGTCGAACCGCCGGCGGCTCAGCTGGGATGGGCCGCGTCGACGACACCGCAGTC
GGCCGACGACGGCCGTGACCAACCTGGCTGCGTCGACAGACCTCACCGCATCGACCGAGTTCACACGGTCGCGGCGATAC
AGCACCACGTTCGAGGACGCACCCGAGGATGCGGTCATGTTCTCGTCCAGCGTCATGCTCAAGAAGCGCATCGTGCACAC
TTACGTGCAGCTGTGCGAGCTCAAGTCGTATGTGCAGCTCAACAAGACCGGCTTCCGCAAGGTGCTTAAGAAGTTCGACA
AGATTCTCGACACTAACCTGCGTCCGGCTTACATGGCCGCCTCGGTCGAGCCGGCCTTTCCGTTCCGCTCCGAGACCTGG
GATGCGCTGCTGCAGAACATCACCCGCATGGAGGCTGCCTACACCGACGTCGTGACCGGAGGCGATGCCGCCACAGCACG
CCGCGACCTGCGCTCCCACCTGCGCGAGCACGTCGTCTGGGAGCGCAACACCGTGTGGCGCGACATGATCGGCATCGAGC
GGCGAGCCGAAGCAGCCAGCCTAGGCGGACTGGCTGGTCGTGGACTTGGTGGCGGTGGACTCGGTTTAATGGCGGCTGGC
AGTGCCGGTGGTGGCAGCGACGACGACGACGCCAAGAATCCGCGACGGCCAGGCGCCCGTCTTCGTCAGGGCGATGACAT
GGAGCCGCAGGCCCTTCCGGTGCGACGTATCCGGCTGCTCTCACACGTCGTCGTCGTGCCGGCATGGCTCGTCAGCAGCT
CCATGTTGACGCTGGTGACCGTCGTGGCCGTCTTCTTTGGCGTGCTGTATGCTCCCGGACTGCTGGACGGCCTGCCGGAG
CAGCAGAACTGCCTGGCCATGCTGGTGTTTGTCAGTCTGTTGTGGGCCACTGAGGCGATTCCGCTGTTCGTCACATCGTT
GATGGTGCCCTTTCTCTGCGTCGTGCTGCGGGTTGCCTGCGACGATAGCGGCACCGACCAGCACCGCCCGCGCCGTATGG
GATCCAAGGAGGCTGCCGGCTTCATTTTTGCTGCCATGTGGACGCCCGTCATCATGCTGCTGCTGGGCGGCTTCACGCTG
GCGGCCGCCCTCAGCAAGTGCCGCATCGATAAGCGTCTGGCCACCTTTGTGCTCAGCAAGGCCGGCACCCAGCCGCGCAC
CGTGCTGCTGGCCAACATGTTTGTGGCCGCCTTTGCCAGCATGCTGATCAGCAACGTGGCCGCGCCGGTGTTGTGCTTTG
GCATCATTGAGGTGAGTTTGCTGACAAATTGCTGACAAATCAGAAAACTGACAAACAACCACAGCCCATGCTGCGCAACC
TCCCGTCCGAGTCCAACATGTCCAAGGCGCTCATCATCGGCATTGCCCTAGCCTCCAACATTGGTGGCATGCTGTCGCCC
ATCGCTTCGCCACAAAACGTCGTGGCCATCGGCATCATGACGCCCGAGCCGCCCTGGCTGCAATGGTTCTTCATCGCCAT
CCCGGTCGGCGTCGTGTCCATCCTGCTGATCTGGCTGCTGCTGCTGGTCAGCTTCCGGCCTGGTCGCGGCACCACCATCG
TGGCCGTGCGTCCGGTGCGCGAGCGCTTCACGGCCGCCCAGTGGTTCGTCACCCTCGTCACCCTCGTCACCATCGGCCTC
TGGTGTGCCAGCCACAATCTCGAGGACACCTTTGGCGACATGGGCGTCGTGGCCATCCTGCCCATCGTCATCTTCTTCGG
CATCGGCATCCTGTCCAAGGAGGACTTCAACAACTTCCCCTGGACCATCATCATCCTGGCTGCTGGCGGCCTGGCTCTGG
GCAAGGCCGTCAAAGCCTCCGGCTTGCTCGACACCGTGGCTGCCGGCATCACCGTGCACGTCCAGGGCATGAGCCTCTAC
GGCGTCCTGGTCGTCTTCTCCACCCTGATTCTCGTCATCGCCACCTTTATCAGCCACACCGTTGCCGCCCTGATCCTTCT
GCCGCTGGTGCACAACATCGGCGCCGACATGGCCGAGCCGCACCCGAACCTGCTGGTCATGGCCGGCGTCTTGATGTGCA
GTGCCGCCATGGGACTGCCGACGAGTGGTTTCCCCAACATGAGTGCGTTTTGTTCCTTGATTTGCTACGTCTGTTTTTCA
TGCTGTTCTCGTTTCACTGCTAACTCCTGCAGCTGCTATCATGAAGGAGGACCCGGCCGGCCAGCGCTATCTGCGCGTCA
AGCACTTTATCACGCGCGGTATTCCCAGCAGTCTGATAACGCTCGTGGTCGTGCTGACCATTGGTTTTGTGGCGATGCGG
GTGACGGGAATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62