GenePrediction:GLEAN_7046 Details

Name: GLEAN_7046
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:132669..132003 (- strand)
Length: 667
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:132669..132262 (- strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_108:132194..132003 (- strand)
Length: 192
>GLEAN_7046 class=GenePrediction position=GCSC_108:132669..132003 (- strand)
ATGTCGGCGCCGTTATCAAGCCCGGTAGTCAACCAGTTGGGCGGCAATGCGTCCGAGACGGTTGCTACTAGCAGACCGCT
CGAAGATGCACCCGACTTACAAGTGTGCAGGCACTGCAAGGAGACCATACCAAGCACAACGGCCGAGAAGCACGCCCTAG
AATGTCGGAAGATTAGGAAGGAAAAGGTCCAGCATATGGCGAAGGCCAAGAAGGCACACAAGGAGGAGGCTGCGCGCAAG
GCAGAGCATGGGGCTAGAGTCGCCAAGGACGACGATAAGTCCTCTATCCCTAACGAATCTCGCCACATAGAGGCTCAAAG
ACTCTGTTCAAGGTGTCGCAATATTGATATTGAGGCTATCTTCGAAGACGGAGAGCGCAGTCAAAAACAATATTATGGGT
TCAGCTCTGTATTCCTGGGCGCCTTACCCGCCTCAGGAGATCAGACCCTAAGTGCTATGTGTGAACTATTCGCAGAAACA
CGGCTATATCAAGATGAACCAGCACACGACAATTATAATATTCAAGCTTACAGTAGCGCACTTAGAGAGAAAGGACAAGA
ATGGAGGAAATACGTTGGACAAACACTCGGTTGCGTTCTGGCTGTTCAACATGGTGAAGGATCTATCTATGGCGGCACTA
CCGAATGGGGAACTGCAGAACGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62