GenePrediction:GLEAN_7047 Details

Name: GLEAN_7047
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:129619..127060 (- strand)
Length: 2560
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:129619..129185 (- strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_108:129102..127863 (- strand)
Length: 1240
Type: CDS
Source: GLEAN
Position: GCSC_108:127703..127060 (- strand)
Length: 644
>GLEAN_7047 class=GenePrediction position=GCSC_108:129619..127060 (- strand)
ATGAGCGACGCTGAAGAGCTGCTTGAGTTGCGGCAGGCGGTTGCCGCATACCGGGCGCAGGTAGCAGCGGCTAATGAGCG
CGCCGAAGCTGCCGAAATCCGCCATAAAGAAGAGGAAGACCGCCGCCGCAAAGAAGAAGTCCTCCGCAAAGCTGCTGAAG
CCCGCCAGAAAGAAGAGGAAGACCGCCGCAAAGAAGAAGAAGTCCGCCGCAAGGTTGCTGAAACCCGCCAGAAAGAAGAG
GAAGATTGCCGCAAAGAAGAAGAAGCTCGCCGCAAAGAAGAAGAAGCTCGCCGCAAAGAAGAAGAAGTTCGCCGCAAGGC
TGCCGAACAGCAACTGGCTCCCTCCGATTACAACACCTATCTCGACTTCTGTCACCGGGACATCTCCCTCAAACTAGCTA
TCGAGACGAATGCTCGCCTAGCCTTTACTGGCATCGTCGCTAACCCCAATAACAAATACTATCCTCTGCACTTCAAGCCG
TGGGCCGACTTTTCTGAGATGCACGCCCGCCGCCAAGCCGCTCTTCTGGTCGCCTGGCCATGTCGGCGTCGTCCAGAAGC
TTGTACAGAGCAGGAAGATGACGGACGAACAGGACATGCGAATGTTTCAATTTCTGGCCGTCGAGTTAGGTGTGCGTGAG
GTGTTACTTACCTTTCTCCAAGAGACGAAGGCAGCGGCCGACATGGAAAAGCAGAAGCAGCAGCAGCACGATCAGGGAGA
GGAGGAACGGGAACAAGAAGAAAGCCGCTCTGAGGAGACGCACTCTCTTCCGACCACCATCCTGTTCGAAAGCGTGTCAT
ACGGGCTGTCGGTCTACGATAGCGATGATCCCGACCTCGACAACCCCAATCGTCCGGCGTATAAGCCGGCTCTGGTGCTG
GCCCGGCAGCAGGATAGACAGGATCGGGGGCGACCGCGCGGCGAAACCGACGACGGACCCCCTCTTAAACGGGTGTCGTC
GCCGACGCGCAAGCACTTTCCCGACCAGTGGCTGATTCGGGAAGAGGTGGACGGGAGGATCCGGCCTGTTTTCATTGTCG
AATACAAGGCCGCACATAAGTTGCGTGCCAGTATGGTGAAGTTGGCCTTGGACAACGCGTCGAACGGGGGCTTGTTTGCA
GCGGCTCTACGCAACAAGCTCAGCAATACCGTGCCGCAGGAGGGGGACGAAAAGATGCTGGCAGAGGCCCAAAACGCTAC
AGCCGCGGTCGTGACACAAGCGTTCCACTACATGGTTGAGTTTGGCCTGTGCTACTGCTATGCGACGTCAGGCGAGATGA
TCCTACTGTTGCATCTCCGACCGGAGGAGCCAGAGACCCTGTATTACCATCTGTGTGTGCCTGCAGACGAGATGACCGAA
CGGATCTCGGACCAGATGGGACTTACCATGCGATCAGCCGTGTCGGTGGTGTCTGCACTAGCTTTGCTCGCTTTGGACAG
TCCTCTTCTGAGCCAGCGATGGAAGCTGGAAGCGGATAGCCGGCTGAAGCGGTGGCCGACAGCGTATCCACAGATGGAGG
CACACCTGCCCCAAGACAGCGGGAGTGAAGAGAGCGATGGGAGGCCGGCGGTTCCGTTGCTGCCTCCACCGGGAACCGGG
GAGCAAGATTGCCGAGACCCGACCAAACCAGGACGGAAACCGCCCAAGGGCGATGGGGATGGGGATTTCACACCAGCACG
TTCGACAGGCGCGGTGACCGGCAAGTCCTATGCCACACGGTCGGCGGCATCGCGAACGCAGGGCTCTGGCAGCAGCAGTC
GAGGAGAAACGTCCGATAAACGAAAGGCAGCGCCGTACTGCACGTAGGCCTGCTTGCTCGGACTACGAAACGGCGGCAAG
CTGGATGGCCAGTGTCCGAACGTGGAACGGCACCGACGATGCTGCGGCGAGGACGGGCGACACGGGCTGTCGGCAGAGCA
GCTGATACAGCAGCTACAGGAACAGCTGGGGGAGGACATGGACAACCACTGCGACGCGCTGGATCGGTATCGCAAGTGTG
GTGCGATCGGCACGCTGTTCCGGCTGACGCTGCCGGAGTCCGGATACTGCGTTGTTGCCAAGGGAGTGGAGCGGGAAAAT
GCTCGACGACTGGAGGCAGAGACGGCCATCTACGACTACCTGCACGACTGGCAAGGCGACTTGGTGCCGGTGTGTCTGGG
GACGGTGGAGCTGGTGCACGACTACATCTCGATGCGAGGGATCCACGTGACGCATATGCTGGTGCTGTCGTACGGTGGTG
AGCCGGCGCTGGCCGTGCAGGTGCGAGACAGGCCGGTGCCGACGACGGAGACGCTGCAGCAGCTGGCCCACCAGGCCTGG
TTCCAGTTGGCCGCGACCGGGATTGAGCACGGGGACGAAAGAGAGGCAAACATGGTGTGGAACGAGGAACGACAGCGGAT
GATGTGTATTGATTTTGACCGGGCCTGGATCGTGAAGCCGAAGACGAAGAAGGGTCGAGGGTCAAGGGAGACGGGGGAGA
CGGACGAGAGGCTTTGGAAAAAGCAGCGGTTGCACGGAGTGACGACGAGGAAGTCTGATATGGCCGAGGTAGGTTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62