GenePrediction:GLEAN_7048 Details

Name: GLEAN_7048
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:119524..117004 (- strand)
Length: 2521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:119524..119434 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_108:119357..117004 (- strand)
Length: 2354
>GLEAN_7048 class=GenePrediction position=GCSC_108:119524..117004 (- strand)
ATGCCTTCGACACTGGCTGAGCACAGCCATAAGGCGACAACGAAAGTCGGCCACAAGCCCTTCAAGGGGGGCAAAGGACG
GAATCGCAAAGGTTGGTGGAGAAGGAGCGATTCAGCTTAGAGGCTATAGACAGAAGAAAATATGCTGACATTTGTGCGAA
AATATAGGCAAAGTCTTGGATGAGAGACCAAAAACGCCGCACCAGCAGGTGATGTCGAAACTCGATCGTCGCAATCAGAA
CCGCCAGCGCCAGCTGGAAAAGCAAAAGGAGCAGCGTCTTGACGCCTCCATCTTTACCGGCCGCGATGGTGCGCCGCGCA
ACGTGGCCGTGATCCCACTGTGCAGCAATTGCGATGCCGCCACCACCATCCGCGCCCTCAATGTCAGCTTGGACATTGAG
GTGGACATCACCGACGGTGCGGTGCGCGTGCCCGTCGAGCGGTTCAAGCAGCAGCTGCAGTACATCGTGGTGCCGTCGAA
CCGCGACGTCGTGGCCTGCTTGGATGCCGCACGGGCTGCCGACTTTGTCGTCTTTGTCATCTCGGCCGTCGACGAGGTGG
ATGAGCGTGGCGAGCTGATCCTGCGCAGTGTGGAAAGCCAGGGCCTGACAACGCTGTTCACGGCGGTGCACGGACTCAGC
AGCGTCGAGTCGGCCAAGCAGCGCACGGCCGTATTGGAGTCGCTCAAGTCTTTCATGCGGCACTTCCACCCAGACCAGGA
GAAGCTTTTCAGTCTTGAAAGCCGGCAGGAATGCGCCAACCTGATGCGGTCTCTGTGCAATGCGACGCCCAAGGGCATCC
ACTGGCGCGATGAGCGGAGCTGGATGCTCGTGGAGGACGTGCAGTTCGGGACCACAGGCGACGATGCTGCTGCCGTCCTC
ACGGGTGTCGTGCGTGGCAAGGGACTCAACGCGGATCGGCTCATCCACGTGGGCGACTGGGGCTCGTTCCAGATTGACAA
GATCACCGCGGCGCCCATCTCGGTACGCAAGCCCAAGGGCGGTGCTACCGTCGAGGACATGGCTGTCGACGGACAAGAAG
GAGGCTCAGAGATTGTACTCGCCGAACCCAGCGAAGACAGGGACGATTTAGACGGTCTTGCTCCCGAAGAGGCCGTTCTC
GACCAGGATGACGAGATGGAGGACGAGGAGATTAACAACCGGTCCCTGGAAGCCGCTGGCCGAAAAGGTGTATTGTTGGA
TGACCACCATTACTTTGACGATGACGAGGACCAGTTCCGGCCAGCCAAGAAGCTTCCCAAGGGCACATCAGCGTACCAGT
CGGCGTGGATCCTGGACGATGTGACGTCAGAATCCGGGTCCGACAACGATGACGAAGAGGAGCAGATGGGCGATGACGGA
TTCAAAAAGGCCGAGCCGGCAGACGGAATGGAAGGCCTGGCACACGATGCACAGACCGAAGGTGCTGGACCGTCCGAGTA
CCCGCAGTCGGAGATCTATGTTGAGCAAAATGAGGAGCAGGAGGCCGAGCAGCTGGCGCAGTATCGGCAGCAGAAGCGGG
GCGAGGCCGAAGACGATTTGGAGTTCCCAGACGAGATCGAGCTGCACCCACAGGTGCTGGCACGTGAACGGCTAGCACGG
TACCGCGGTCTCAAGAGCCTGCGGTCCAGCCCGTGGAACGCAAAGGAGGACCGTCCACACGAGCCAGAGGACTGGCGGCG
TCTGTTGCAGATTCCCGACTACAAGTCGTCGAGAATCCGGGCAGCCCGGGAAGCATTGGTCGGCGGGGTGGCGCCGGGAA
TGCGTGTTTCCGTGCATTTGGCCAAGGGCGTGATTCCCGAGGCCGTGCGGGCAGCCTACAGCACGAGCAGGCCAGCCGTG
GCCTTTTCTCTGCTGCGACACGAGAACAAGCAGACGGTGGTCAACCTGATCATCAACCTGAGCGCCGACCACCCGCACTC
GATCAAGGCCAAGGAGGAGCTCATCGTGCAGTGTGGACCGCGTCGTTTTTTCGTCCAGCCGCTCTTCTCGCAGAGCGGCA
ACACGCCCAACAACGTGCACAAGTCGTGCCGGTTCGTGCACCCTGGCCAGTCGGCCGTGGTCAGCTTCGTCGGCCCCGTC
ACCTGGGGCTTCGTGCCGACGCTCTTCTTCAAGCGCACCAAGAGCGACACGGTACCGCTGCAGCTGGCTGGCATCGGGAC
GTCGCTGGCGCCATCGACGGCGCGCGTGGTGGCCAAACGGGTCGTCCTCACCGGCCATCCGTACCACATTCACAAAAAGG
TGGTTACGATCCGGTACATGTTCTTCAACCGCGAAGACGTGGACTGGTTCAAGGCGCTGCCGCTATGGACGAAGCGTGGG
CGCAGTGGATACATCAAGGAGGCTCTCGGCACGCACGGCTACTTCAAGGCCACGTTTGACGGTCGCATCAACCCACAGGA
CAGTATCGGTGTCAGCCTATACAAGCGGGTCTGGCCACGGAAGTCGCTGTTGTACCAGGAGTGGGCTGCGCCGCCGGCTG
AGGAGATTGTCGACGAGATGATGGATGAGGCAATGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62