GenePrediction:GLEAN_7049 Details

Name: GLEAN_7049
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:113315..112160 (- strand)
Length: 1156
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:113315..113190 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_108:113124..112500 (- strand)
Length: 625
Type: CDS
Source: GLEAN
Position: GCSC_108:112362..112160 (- strand)
Length: 203
>GLEAN_7049 class=GenePrediction position=GCSC_108:113315..112160 (- strand)
ATGACCATCAGCGTGGGCATCAACGGATTCGGCCGCATTGGCCGTATCGTTTTCCGCAATGCCATTGAGCACGGCGAGGT
CGACGTCGTCGCCGTCAACGACCCGTTCATCGAGCCGCACTACGCTGTAAGTTGTTTCCACGGCGCTGCAAGTGGTGTTT
CGGCTGTCTAACGGGCTTTACTTCTTTCCAGGCCTACATGCTCAAGTACGACTCCACCCACGGCGTGTTCAAGGGTGACG
TCACCGTCTCCGGCAGCGACCTGGTGATCAACGGCAAGACGATCAAGTTCTACCAGGAGCGCGACCCGGTCAACATCCCG
TGGAAGGACACCGGTGCTGAGTACGTTGTCGAGTCGACGGGTGTGTTCACGACGACGGCGAAGGCGTCTGCCCATCTGAA
GGGTGGTGCCAAGAAGGTGATCATCTCGGCCCCGTCGGCCGATGCGCCGATGTACGTTGTCGGTGTGAACGAGGACAAGT
ACGACGGCAGCGCAGACGTGATCTCGAACGCGTCTTGCACGACCAACTGCCTGGCGCCCCTGGCCAAGGTTCTGAACGAC
AAGTTCGGCATTGTTGAGGGTCTGATGACGACTGTGCACTCGTACACGGCGACGCAGAAGACGGTGGACGGCCCCTCGGC
CAAGGACTGGCGGGGTGGCCGCGGTGCGGCACAGAACATCATCCCCAGCAGCACTGGTGCGGCCAAGGCTGTCGGCAAGG
TGATTCCGGAGCTGAACGGCAAGCTGACGGGCATGTCGCTGCGTGTGCCGACGGCCAACGTGTCGGTTGTCGACCTGACT
GTGCGCCTGGAGAAGGGTGCTTCGTACGACGAGATCAAGGCTGCCGTCAAGGAGGCTTCCGAGGGCTCCCTCAAGGGTGG
GTTTCTTTTTTCCTTTTCTTTTCTTTTCTTTTCTTTTTCACTTCCTTTGTCGTCACCTATGCTAACCTGACAGGCGTCTT
GGGCTACACCGAGGACGACGTTGTGTCATCTGATCTGAACGGCAACAACAACTCGTCGATCTTCGATGCCAAGGCCGGCA
TCTCGCTGAACCCCAACTTCGTCAAGGTGGTCAGCTGGTACGACAACGAGTGGGGCTACTCCCGCCGTGTCCTGGACCTG
ATCGTCAAGGTTGCGGCTGTCGACGCCAAGAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62