GenePrediction:GLEAN_704 Details

Name: GLEAN_704
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1539747..1541650 (+ strand)
Length: 1904
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1539747..1539811 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_97:1540468..1541328 (+ strand)
Length: 861
Type: CDS
Source: GLEAN
Position: GCSC_97:1541389..1541650 (+ strand)
Length: 262
>GLEAN_704 class=GenePrediction position=GCSC_97:1539747..1541650 (+ strand)
ATGACATCTCTTGGTCACGATTCGGTCACTATTGACCGCTTACATTTTGAGACTCTCGTACGCAGGTGAGCAAGAGCTTT
TACTTCCATATTTACACCTTCACTATGCAGGTTGGTCTGTGGCCCAAGACATGCGTTTCTCCTCCGTCTTGCTCCCATTC
TCTTACACTGCCAACACCTCGCCTCCTATATTTGAATTTTACACCCCTTCTGCTCATTTGCCTCTCCTCTCTAATGTCGT
GTACATCAATAAATTGGATTCTAACGGCCTTCCCCAGAGCTAATATCGTAGGTCTCCCCACTTTGCCGTTGTTCTGGCTT
CTGGCTTCTGGCTCACATCTGTCTCAATCTTTTCTGCATGCAAATGGGGTAGAACTCGGATCCAACCAGTTCTACACTTC
CAAAGACTGTACCACCAGATGCAGCCATATATTTATCGCGAACAGATTATGAATATCTGCTGCATGCCGCCCAACAATAT
GGTACGGACCGATCTCTGCATACCTATGCAACACCCACCTTTTACCTTTTTCGGCCAATTCTTATTTCATCCCCGTGACT
GACATTGCATGCCTCGCTTTATTAGCTAACCTCAGACAAAATTTGCTCCGAGGAGGTGTGGTGGAGGAGACCATAGCAGT
AGGCTATCTCCGTGCTTCCCATCGTGTATCTGCGTGCTCTGCTAATCGAGCCGCTCTTTCACACTATAAGCTTCTCAGCA
GGGATGACGGTGCCATACAGAACGAGTACCAGCCGCCGCAAGAGGCCACAGACGACACTAGTGCTGGCTCGGATTGGGGC
CCAGACAGTGGCGGCACTCGTATCCCGTCCGCCACCAGTTTCTATGATGCTCCGTTCAAGAGGCGCTTGCCTAACGAGAA
CGCGGACACTGACTTCGGTTCCGGCTACCACTACGCCAACGCTCAGAACTACATCCATGGTGCCGGCGGCAATGACGGCC
CTCCCATCCTGAGGGACCGGTCACACAACATGTTTAACTGTTTTCATGGCAACAATGAAGCTCCGAATGTCGACCGCAGC
ACAGTCCCGCGAGCTCAGGGCCAGGGTCACGAACAGTTTGGCTTGGCTGGTGTCCGGGGGTTTGGTCCAGTGCTCGAACG
CAACTGCAGACGGACTATCCGTGTCATGAACATGCCTGTCGGGACCGCACATGCGGCTTTGGTAGCCGTTATCCGCGGCG
GACCCGTGCTGGATATTTACATCCGCACACATGACCACTCTGCCATGATCTCGTTTCTCTACCCAGCCGATGCGACAGCC
TTCTTCGACCATGTGCAGAAAACCGGCCTCTACATAGAGCAGAAACGAGTGAATGTTTGCTGGGCCGAACGGCAATTTAC
ACTTCCTGGTGATGTGGCCCACAAGATTCGGAACGGAGCCACGCGCAACCTGGTGATCCGCCGGTGCAACCCATCCGTCA
CAGAAGAGATGCTCCGTGAGGACCTCGATCACATCCACAACATTGTCATCCTCAAGGTCGAATTTACTAAAGGAAGCTGC
TACATCAGCACCAACTCCGTCCACAATGCCTTGTTTGCTCGAACTTGCATGATCAGCCGTTCGTAAGTGCAGTGTGTCGG
AAGTGCAAGGTGATGGTGTTCAGAGGACTAACGTACAAACAGGAAGTTCAAGGGCTCCAAGATTGAATGGTATCCTGATG
AGTGTGCACAACCTCTGGAAAGTTTTCACCAAAACGTCCAGCCATCCTCGAAGCCGAAGAAAGTGGCCGTTACGACCAAG
AAGCTCGCCATGCCCAAAGTGGCGAACCGCTTCCAACTGCTCGACCTCGCCAACGGAGATGATGAGAACAGTGAATATGA
TGACGATAACTATGGCACGAGTGGCGCGCCAAATGCTGAGATTGCCCTCCTAACGAGTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62