GenePrediction:GLEAN_7052 Details

Name: GLEAN_7052
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:72334..70494 (- strand)
Length: 1841
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:72334..71780 (- strand)
Length: 555
Type: CDS
Source: GLEAN
Position: GCSC_108:71723..70494 (- strand)
Length: 1230
>GLEAN_7052 class=GenePrediction position=GCSC_108:72334..70494 (- strand)
ATGATCGCCGCAGCCAAGTGGTGTGTGGCCCCTGACAAGTTGGCCGTTTGGACGCAACGAGTCGGAAGTACTGCACGAGT
ACAGCACAGGTTGTGCGCAAAGACGGCCAGAACGGAGCGCGATACGCTCTGCACGCAGATCCCCTTGGTCCACAGACGCA
AACGGTCCCGCGCTTGTCCGCACTCTCTCGGAGCTCAGCCCCTCTGGCAGCAGCCTGCCAACAACAGACGGCAGGCCATG
AAGGCAGTCTTGCCGCGCCCACGTGGCCGCTGGGACCAGGCCGTGCCGCCGGCGCTGCGGCCGCTCGTGCGCGCATACCT
GCTGGGCTATGCGTCGACGGTGGCGCCACAGCTGCTGGCGGTGCTGCTGGCGGCGTATGCAGCGTTGCGGCGACGACGGC
GAGCTGCAGCAGAGGGCCTGCCACCCGAGGCCGAAAAGACGGCCTCTCTTGCGGCTGTGGCTGCCTCTGTGCGGCGCATT
TTCGGCGACGGGCTGGCCTGGCACGGCTTCCCGACCTTTTGTGCGGCTCTCGTCGGCGGTGGCACGCTGCTCGAGGTAGG
CTGGCCTCCACTTTCTGACGCTGGCTCTCGCTTCACCGGCTGACTCTCCAGGTCCCGTTCGACAAGCTGCTCTCCCGGTG
GCCGACTGGCCTGTCGAGGCTGGCCCGAGCCCGTCTCGCCCGCTGTCTGGCCAGCTTTGTGTCGGGGTACTGTAGCATAC
AGCTGCTGCAGGGGAGAGAGACGACTGACGAGAGAGAGAGGAAAACGAGTGATGACGGATCAAAAGCCAGAGAACCAGCC
ACAGAACCGACCAAGACGGCCGGCCGCACGCTCGACCTGACGCTGTTCGCGGCCACGGGTGCAGCCGACGTGTTGGTGGG
CAGCCTGTGGGCGCGGTGGCGTGGACGGCGGTCTGCCAGCCAAAGCAGACGGCGCTGGACGCGGACAGAGGCGCTGGTGG
GTGCGGCGATAGACCCTGCGCTGTTTGCGCTGTCGTCGGCGCTGGTGATGTGGACGTGGATCTACGAGCCGTGGCGGCTG
CCGCGTTCCTACGACCGATGGATCACGGCGGCCGCAGCCGTGGACGGACGGCTGATCGAGGCGCTGCGACGGTGTCGTCG
AGGGTCGCTGCGATATGGAGAGCAGGCAGATCGGCCAGACAACGACCAGAGCTGCCTCCTCCAGGAGATGTGCCGCGACT
ACGGCTGGCCGCCGGTCTGGGGCGACCCCGCCTTCACGATGCCCTTTCCCTGCGACATGGTGCACATGGGCTGCGGGCCG
TCGTGCGAGCGTCACGCTGTCGTGCGACTATGGCGATCGTGGCGCTGGGCTCTGGCCACCTATCTGCCGCTGAGCCTGAC
ACTGCTTCTGCGGCCAGTGCGTGGTGCTGGTGGTGCTGCTGCTCGTCCCCGTGCCCTGCTCCGTCGCCTCGTGCGCGCCC
TTCTCGCTGCTGCCCGCTCGTCTGCCTTTCTCGCCGCCTTCGTCTCGCTCTTCTTCTACGGCGTCTGTCTGGCTCGCGTC
CGCATCGGTCCCCGCCTGCTCGGCCGCTCCGCCGCTGCCTGCCAGGCCATCGATGGCGGCCTCTGCACCGCCGCTGGCTG
TGCCCTTTGCGGCTGGAGCATCTTGCTTGAACGTCCTGGCCGCCGCAGAGACATCGCCCTCTTCGTCGCTCCGCGCGCCC
TCGCCACCCTCCTGCCGCGCCGCTACCACCACCGCTACCTGTGGCGCGAGTCCCTGCTCTTCGCCGCCAGCTCCGCCGTC
GTCCTCACCACCGTCCGCGAACACCCCCGCCGCGTCCGCGGCCTGCTCGGCTCCGTGCTCAAGACCGTCGTCGCCCCGTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62