GenePrediction:GLEAN_7053 Details

Name: GLEAN_7053
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:64416..63847 (- strand)
Length: 570
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:64416..64045 (- strand)
Length: 372
Type: CDS
Source: GLEAN
Position: GCSC_108:63987..63847 (- strand)
Length: 141
>GLEAN_7053 class=GenePrediction position=GCSC_108:64416..63847 (- strand)
ATGACAGACACGGCTCGGTGGAAGGCCACCGTTTATGTTGGCGGGCTAGGACCGCAGGTGACCAAGGCCAACCTGCAGGA
CGCCTTTCTTCCGTTCGGCGACATTGCCGATGTGGCGCTTCCCAAAGGCAGTAACAGGTCGAATGGCGCCCAGGACAGAA
ACGACGACACTGCGCCGCAACAAGACGACGACGGCGAGCCCGGTCACAGGGGCTTCGCCTATGTCGAGTACGAGGACGTC
GACGACGCGAAGGAGGCCATTGACAACATGGACAAGTCCGAGTTTTTTGGGAGAATTATCAAAGTCACGGCTGCAAAGGC
CCCCAAGAGCGCGAGTGAGGGGCTGGGAAGCCGAACGGCTCTCTGGAAACAGGTTCGTCTAATGCGTCCGTGCTTTGCCT
TGGTTCGCATGCAGCTGACCATCAACTAGGATGCATGGCTTGCCGAGAACACAACAAGCGAAGAAGACAGATTGGCTGCC
GAGCAAGGACTGCTCGGCACACAGGAAGCTCCGGCAGACCCAATGCAGGGTCTAGAGGGACTGGACGTTGCCGGACCGAG
GCCGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62