GenePrediction:GLEAN_7054 Details

Name: GLEAN_7054
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:62448..61757 (- strand)
Length: 692
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:62448..62403 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_108:62115..62003 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_108:61919..61881 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_108:61813..61757 (- strand)
Length: 57
>GLEAN_7054 class=GenePrediction position=GCSC_108:62448..61757 (- strand)
ATGTCCGACGACGAGCGTGTCTCCAAGCCCTTCAAGTTCGTCACAGGTACGTATTTCGTCCCCTCGGCTGCCGGAGCAAG
ATTAGAGAAAAAAATATCACAATCATCGTATGACACCGTATGGCTGACACTGACCTCGACTCACAGCTGGTATGCCATCC
TCCTTCCTCCCCATTTTCACCAATTTGCGCTCTCGAGATAGCTTCGAAAGGATGTGGACTCGACAATTGCGTTCCTCGAG
ATCCCCAGTTCCATAGCGAAAGTGCGGTAGCGCGGGATTCGTTTAGGCGCCAAAAGAACATCTACGATTGACATGTGTCT
TTTCATTTTTTAGGTGTCGACGCCCGGTTCCCCAATACGAACCAGACCAAGCACTGTTGGCAAAACTACGTCGACTACCA
CAAGTGCATTCTGGCCAAGGGCGAGGATTTCGCCCCCTGCCGCCAGGTCCGTACCGCGAATCCCAGCGTCATGCGGTTGC
TGTTGTCTGTTTGTATGGCTGACTTCGCGCATGCTGACATTATCTGCAGTTCTGGCTGGCCTACCGGTCCCTGTGCCCTA
GCGCCTGGGTAAGTCCACGAGAAAGACAGCTCGTTATACGTATGTATGACACGCTTTACTGACAGCCGCATTTAGTACAA
GCGCTGGGATGAGCAGAGAGAGGCGGGCAGCTTTCCGGCACGCCTGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62