GenePrediction:GLEAN_7055 Details

Name: GLEAN_7055
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:59839..58984 (- strand)
Length: 856
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:59839..59763 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_108:59606..59555 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_108:59450..59370 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_108:59271..58984 (- strand)
Length: 288
>GLEAN_7055 class=GenePrediction position=GCSC_108:59839..58984 (- strand)
ATGTTGATTCCGAAGGCCGACCGCAAGAAGATCCACGAGTCCCTCTTCCGTGAGGGTGTCCTCGTGGCTCCGAAAAAGTA
TGTTTGTACTCCGAGAAGGCACTCAGAACACCTCATTGGCGCATTCGCTAGGACGCTTCAAAATCGCCGGGATTTCGCAG
TCGCTGCCTGCGAAGGGGAATCTGGTGCCGTCTTTTAATACAGGAAGAGACTGACCTTTTTTCCCCATCGCAGCTACGAG
ATCCCTCACCCGGAGATCGACACCAAGAACCTGTTCGTGATCAAGGTGGGATATGCCGAAAACCCTTGGACGAGAGAACA
GCAACAAGAAAACACGGAAGCGAATGCTGTATAAATCGAACCCAGTGGCTAATATAACCTCCCGAATAGGCTTGCCAGTC
CCTCACCTCGAAGGGCTTCGTCAAGACCCAGTTCTCGTGGCAGTGGTACTACTACACCCTGACTCCTGAGGTACGAAACT
TGCCAGCTATGCATCCCTTCGGCATTGAACACATCTAGCCGACTGGGACATTCTGAAAGTGTTTCGGGCTAACATGCTCG
TCATATAGGGTCTCGACTACCTCCGGGAGTGGCTCCATCTGCCGGCCGAGATCGTCCCCTCCACCCACATCAAGCAGCAG
AGATCGCATGCCCCCCCTCGTGGCATGATGGGCGGCGAGGAGCGCGAGCGGCGGCCGTTTGGCGGCCGTGGCCGTGGTGG
TGAGCGGGGAGACCGCGAGGGTGGTTACCGGAGACGGGATGCTGGCGAGGGCAAGGAGGGCGGTGCCCCTGGCGAGTTTG
CTCCTCAGTTCCGTGGCGGTTTCGGCCGTGGCCGCGGTGCTGCCCCCCCGTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62