GenePrediction:GLEAN_7057 Details

Name: GLEAN_7057
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:55121..51336 (- strand)
Length: 3786
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:55121..54494 (- strand)
Length: 628
Type: CDS
Source: GLEAN
Position: GCSC_108:54426..52330 (- strand)
Length: 2097
Type: CDS
Source: GLEAN
Position: GCSC_108:52261..51336 (- strand)
Length: 926
>GLEAN_7057 class=GenePrediction position=GCSC_108:55121..51336 (- strand)
ATGGCTTGGCCACCAGTCGGGCCGCTGGGCCAGACATCCTCTCCTGCAGACGGCAGAACAACTTCGCACCACCACCGTAC
TCCTAGCACAGCAGCACACGCGTCTCGACGCAGAGCCCACCCCGATCCTCTACCCACGAACCTAAACCCTACAGTCTCTA
ATAGCCTAGATCCCGTCAGCCTCGGATCCCTAGATATTGCCCAGCTCCAGGTCGAATCGAGCTCCGATTCCGACGCTCAG
CACTCCCGCCATCCCTCCAAGCCGAGCCACGGACGCTCCATGAGCAATCCGTTCCCGTCCTTGTTCTCGACCAAGAAAAA
AAAAAAGGCCAGAGACCAGTCTCCCTCTGGCTTTAGCGACTCGGAGTCCAGCGATGAAGCCGGCCCGATGCACAAGTCAC
GGGGCAGCAAGCAAGCCCCGCTGCACTCGCTGGCAGCTGCTGGTCCAGGCCGTGGAAACAGCTTCACAACCGGGCCCTGC
ATAACCTGCGGGTCTCTCATGCGGTGGGCCCAGGGTGTCGAAGCCTTCAGGTGCAGCATCTGCCTGACTGTCAACGACCT
TGTGCCTGGTGGGAGGGTGCCGGCTACTGGCTCCGGAAAGCACACTCGAGCCTCACAGGCTAGAGATGGTGAGAAGCAGC
CCACCGTCTTTGCTCCAGGCAGTGCTCTTACCATGCTGACATAGACTCCATTCAGATGGTGCTCCGATTTCGGTCGAACG
GACTAGGGCCTTGGCTCAGCAGTGCATTCGGTCCTATCTCACTGCCGTCCTGTCAAACGTCCATGCCGGCCACGATGTTC
CGCCAAGACAGATGCACCCGACGCCCTCCTCTGCTTCCTCCCCTTTGAAGGCAAACCAACGGCCGGACATCTCCTCCACC
GGACCTACAGTTGCTGCCGGTACAGACAGAGCCGAGTCAGGCAGGCCTCTATTTCCTCCCTCTGACTCCGGAGCCCGGAC
TGCGAATAGCCCAACTCGCCGAGCTCTTCCTAGCAACCGGCCCCCACGAAATTCTAAAACCACCCAAAAGCTTCTCCCTA
CGCCTCCCGGCCCTGTGTTAGGAGAACGGCCTTCTCGTTTGCCGAGTGTCCACTCCTTCCCCCAGACGCTTCCACAAGGT
GTCGATAAGACCCGGGAAGAAACAGAAGCGAAGCGAATATTTAAGCAGTTGGAAGACGACATTATCACGCATTTCTTATC
CATCAACTGTCTGGACAGCTCGTTTGTGCCCAGTCAGCCCGTTGTCAACCAAGGACACCGTCGTGAGGTCTCTGAGGCGA
GCCACCACACCTCCTATGCCCACGAGGACCTCTCCGTGTCTGTAGGAGAATCGGGCCTTCCCGAACTGGACCACAAGCTT
CTTCTTCTTGGGGACGTTGCTGAAAATGGTTCTTGGTGGACGGGGCACCAAATTCCTAGGAGGCCAACACACCCCGATCA
TCGCCGCCAGAGGAGCGAGAGTGGAGTTGTGAGCAGCTCCAGCTGTGCAACCAGGCCCATACGAATCGACTGGCCTGCTG
TGGATGAGTGGTTCAATACGGTTGTCAACGTTGGGGCAACATGGACCGAAGTGTACAACCACCTTGTTGAGTCTAATACT
TGCGTGTCACAACCAAAGATATTACTTGAGCAGATCGAGGCCGAAATTCTAAAGGGGCAGAACCACGTACAGCGGGTGCT
ACTGAAGGCTATAGAAACTGTGCTCAAACGGCCGGGACGTCGCATAGGCGAGTCGGGCGACTTCCGATTCCTGATTATGG
CACTGGCAAACCCGCTCTTACACGCCTCGTGCCGACCATTCGCCGGGGTCTTCCAGCGTACTGCACATACCCAGCAGTCA
CGGCACCAACAAAAGCACGAAGCAAGTCGCGGGAATGGACCGGCATCTGGACAACACTCAGTCATTATCAAGCGCATCTT
GGGACTGATCTCGAACGCATCCGATGAGCGGCAGCGCCATGTGACTTCTTGCTTTTCCCACTTCTCAGTGGCCCGCTTCA
TGCAGATGAAAGATCTAGTGGGCGGTTTCTTGGCGTACCGCTTGGTGCGCCACAACGAAAAGAAGGAGGAGTCCAAGGAC
GAATTTGCAGAGGAGCTGGTGCCCAGAGTGTCAGAAGGGGCATCGGCTGCGTCGCTGCAGGCAGCACTCAGCCAGACATC
GGGGCCGGCTAAGAAACCGAAGACCAAGGCCGAGAAAAAGCTGTCCCATGGCGACGATTGGCAGATCAAGGCCGCCGTTC
GCGTTCTGGGCCTTCTGTTCAATGCGAACAGCGCAGCCTATGCGCATCGACACGCGTCGGACGGTCTGCTCGATGACAAA
GAAAAACCAGGGATGGGCCCACGCGCGAACCTGAACGGCCAGCTTTTGCCGACGTCTGACTTCTACATGACCCTGCTGGA
CAACTGCGATCTGGTAGCGGATTTCGAGTCTTGGGAGCTCAAGACGCCAAAGTTTACGTTTTGCCGCTATCCTTTCTTGC
TGAGCATCTGGGCCAAGATCCAGATTCTCGAACACGAAGCACATCGCCAGATGAGGACCAAGGCGCGAGATGCCTTCTTT
GACAGCATCATGACACACCGAGACTTTGACCAGCATTTTAGCTTAAGAGTCAGGAGGGACTGTCTCGTCGACGACAGCCT
CACGGCCGTGAGCGAAGCAGTTGGCAGTGGCGGCGAGGACCTCAAAAAAGGGCTGCGTATTGTCTTTAGAGGAGAAGAGG
GCATTGATGCCGGCGGGCTTCGCAAAGAATGGTTCCTCTTGCTCGTACGGGAAGTTTTCAATCCAGACCACGGTACGTTC
CTCTGCCTTTCTTGTCTGTGCCACAGCTGGAAGAAATCGGACTGACGGCAGCTACTATAGGCATGTTTTCGTACAATGAC
GATTCCCGGTACTGCTATTTCAACCCCAACTCATTCGAGACATCGGACCAGTTTTTCTTGGTTGGGGTCGTTCTGGGCTT
GGCGATCTACAACTCGACTATCCTGGACATTGCCTTGCCACCATTTGCATTCCGCAAGCTTCTGCTTGCCGGACCAGAGG
CGCCTGCGGGAATGATAACCGGGATGACCCGACCGCCTATCTCTTACACGCTGGCAGATCTTGCAGAGTACCGACCAGGG
CTCGCCAAGGGTCTTCAGCAGCTTCTCGACTACGAGGGTGATGTCGAGTCGGCCTTTTCACTCGACTTTACCATACCCGC
CGAGAAGTACGGAGTGATGGAGCAGGTGCCCCTGTGTGTCGATGGTGAAAAGCGCCCAGTTACAGGGTCCAATCGGCGGG
AGTATGTCCACTTGTATGTCCGGTACCTGCTCGATACCGGCGTGTCTCAACAGTTTGAACCGTTCAAGCGGGGATTCTTT
ACGGTCTGTGATTCCAACGCGCTGCTTCTCTTCCGCCCGGAAGAGATCGAGCTTCTGGTACGAGGGTCTGACGAGCGGCT
GGATATTACTTCTTTGCGCATGGCTGCGAGTTACGACAACTGGGGCGCGCATAGCTCGCCGGAGAGTGAGCCGACCATTC
GGTGGTTCTGGCAGGCTTTTGAGGAAGCATCACCGCAAGACCAGCGGAAGCTACTGACATTCATCACGGGGAGTGACCGT
ATACCTGCGACAGGACCGGCGTCTTTGTCGATCCGCATCCTCTGCCTTGGCAACGACACTGGACGATACCCAACGGCAAG
AACGTGTTTTAACACACTGACTCTGTATCGCTACCGATCCAAAGAGGCGCTGCAAAAGAGGCTGTGGGAAGCCGTAAACG
AGAGTGAAGGGTTTGGCCTAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62