GenePrediction:GLEAN_7058 Details

Name: GLEAN_7058
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:50081..46647 (- strand)
Length: 3435
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:50081..47989 (- strand)
Length: 2093
Type: CDS
Source: GLEAN
Position: GCSC_108:47843..47661 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_108:47589..46647 (- strand)
Length: 943
>GLEAN_7058 class=GenePrediction position=GCSC_108:50081..46647 (- strand)
ATGGCACCAAGCGCGAGGGGTTGGCTGAGGGCAGTATTTGCCGTGGACTCAGTGACCAGCGGTCCTGTCCCGGTTTTGCC
TCCTGCCTTTCTCTGCCCGGCCGTCTGGACGGCACAGGCTCAACGGCCAAGACTTAGAGGGCCGAGCCGACAACAGTCCC
AGTCGACGTGGCAGCAGGTGCGATCACAGAGACGGTTCGTGTACTCAGCTGCGACAGCGGTACATGATGCTTCTGCGGAT
GATGTGCCAGCTGCCGGATTGCGCAAGCTACCACTGCAGTGCCCCGGATGCGGGGCGTATTCACAGACGACACAGGCGGA
CCAGGCGGGCTTCTTTGATCTCGGACGGCGATCGACGATGGAGTACATGGGGCTGGCGGTGCGGGAGAAGCCCCGGGTAC
GGGAGGAGGACCGGGTGGTGGAAGAGGCGCTCCGGCGGATCGACAGAAGCGCGCTGGAGGCACAGGGCGTCGATCTGGGA
GGGCTTCTGTGGGAAAGCAACTCGGGCCAGGAGCTCTCGCTGCGAGAGCACAGCGACGAGACCGACGGGCGGACAAAGGG
ATGGCCATCAATCCTGTGCAGGCGCTGCCACGATCTGGTGCACCACAGTGCCGGGACGGCGATCTACCAGCCGGACATGG
ATGCGGTGCGCGAGACGATTGCCGAGTCGCCGTACAAGTACAACCATGTGTACCACGTGCTGGATGCAGCCGACTTCCCG
ATGTCGCTGCTGCCACGGATTGACATGCTGCTGGACACGATGCCGTTGCGGTCACGCAACCGGCGGGCACGACGAGGCAA
GTTCTTTGGCAACCGCAAGACGGAGCTGAGCTTTGTGATCACGCGAGCAGACCTGTTTGCACCACACAAGCAGCAGGTGG
ACCGGATGATGACGTGGGTGCGTGAGACGCTACGCGACGCGCTGGGCCGGATGGGACGCCACGTGCGGCTGGGCAACGTG
CGGTGTGTCAGCGCGCGACGCAGCTGGTGGACGACGGAGCTGCGCGAGGAGGTCTGGCAGCGTGGCGGCGCGAGCTGGCT
GGTAGGCAAGGCAAACGTGGGCAAGAGCAACCTTGTGCACCAGGTGTTTCCAAAGGGACGGATGGGAGTAGAGAAGGCAG
CTCCGAAGCGACTGCTGTCGCTGGAGCGGACCTCATCGGGGTCATACAGCCTGGAGGGTGTGGACGAAGAGGACGAGGAT
CTCGGCGAGCCGGGACTGTTGCTGCCGCCACGACCAACCGAGACGAACTATCCGCAGATGCCGGTGGTGTCAGCAGTGGC
CGGCACGACGGCATCGCCGATCCGGATTCCATTTGGCGGGGGACGCGGCGAGCTGATCGATCTGCCGGGGCTGGCACGGC
GGGGATTGGCCGAGGTGGTGGCGCCGCAGCATCGTGACGACCTGGTGATGAAGCTGCGCGTGCAGCCGGAGCAGGAGGTG
CTCAAGGGCCCGTGGCAGTCGCTGCTGCTGGGTGGCTTGGTGCGCATCACGCCGCGCACGCCCGACGTTGTCTTTCTGAC
CTACAACTTCTCGCCACTGCCGGCTCACCGCACGCTGACGGACAAGGCCGTGGCAATTCAGCAGCAGACGAGCGAGCTGC
AGGTGCCGAATCTGGCGGCTGTGGGCGTGGGTGCAGACGTGCGGCTGGCCGGCTCGTTTGCGCTGTGCCACGACGTGACC
CGTCTGCGGGCTGGGCCCATCACGCGCAGGGACGCGGCCAACATTGCGGTCGACCGGCTACCGTACCGCGTGGTGGCACT
GGACCTGCTGATCGAGGGCTGCGGCTGGGTCGAGGTGGTGGCGCAGGTGCGCACGAAAGAACTATTTAGGAGGACGGAGA
GGAGGACGGAGAGCATGGAGCAGGCTGACCGGGAAGACAAGTTTGGCATCCTGCAGACGCTGGACTTATCGGATACCCAG
ACTGGCCCCGTTGCCGAGGCAGACTACAACTGGCCCGTCATCGACGTCTTCAGTCCTGGTGGCAAGTTTGTCGGCTCACG
GCGGCCGTTGAATGCGTGGATGATGTGTAAGCCGCCGTCGACGTGGCGCAACGGCAAGGCCGGACGGTCCCGTCGCATCA
TCAAGGGAGAAAGGTGAAGAAACAAGAAGTAGGGGAAACTGGAAGGGCGCCAAGAAGTGGAAAGTCGATGCGGCGCCAGC
TCTCAACTATCAATATGACGGCTGAAATATGTGGGGTTTAAGCATCACGTGACAATATCCCTGTAGAGGCTGAATCAGAA
TACGGGTTATTCCGTACATCACCAAAACTGCATATTCAACGGTCTGCCACGACGAAGCCAAACTCGGTGCAAACGATGAT
GTCGGCTGCAGGCCCGCCCACCTCGACGCAGCAATGAGCCACAACCGGTATACGGCGCACGAGGCCAAGGAGCCGCATCC
GATCTCGCTGAAAGTATTGCGGTATGCAGGCAGCCACGGCTGACCAGTGTTGCTGACACCCGACTCCGTGCTGACTCCCT
ACTCCGACGCAGGCTGTCCCATCCATCGCTAGCAACACAGTATCCGGTTGCGGCACCGCTTTCGACCGCACTTCCGCCGC
CGACGGTGCCGGCCTCGATTGCCTATGGCGGTGGCGGGCCAGACAGCGCGGCCACCAACACGGACCCGTTTCTGCTGAGC
CCGGTGCTCAACCTGCCGCCGTCGTTTGGGTCGGCGTATGTGGGCGAGACGTTTGCGTGCACGCTATGTGCGAACCACGA
CGCGGCGGACGTGGAGGACGGGGGGTGGTCGAAGGAGAAGGCGGCATCGGCCGTAGCCTCGATCCGCGACGTGCAGATCG
AGGCAGAGATGAAGACGCCCTCGGCAGCGGAGCCGGTGAAGCTGGTGCTGGGCCCCGAGACTGACGACGGCGACGGGGCC
GGCTTGGGCTTGCATGCAGGGACGGACCTCGCGTCCGGACAGACGCTGCAGAAGGTGGTCCGGTTCGACCTCAAGGAAGA
GGGCAACCACGTGCTGGCGGTGACGGTCAGCTACTACGAAGCGACGGAGACGAGCGGACGCACGCGCACGTTCCGCAAGC
TGTACCAGTTCATCTGCAAGGCGTCGCTCATCGTGCGGACCAAGGCGGGACCGTACGCAGCCGGCCGAGCGGGCGACATG
CGGCGGCGCTGGGCGCTCGAGGCACAGCTGGAAAACTGCGGCGAGGACGTGATCCAGCTGGAGCGGGTGGAGCTGGAGCT
GGAGCGGTCGCTGACGTACGACAAATACGACTGGGAGGACGGACAGAAGCCGGTGCTGCACCCCGGCGAGGTGGAACAGG
TCTGCTTTCTGCTGGAGGAGACCGGACCCGGACTCGTGCCGGAGCAGCCCAACGGACGCCTGCTCTTCGGCGTGCTGGGC
ATCGGATGGCGCAGCGAGATGGGCAACCGCGGATTCCTGACGACGGGCACGCTGGGCACGCGATCGGCGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62