GenePrediction:GLEAN_7065 Details

Name: GLEAN_7065
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4386296..4385543 (- strand)
Length: 754
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4386296..4386213 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:4386142..4385852 (- strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_140:4385794..4385543 (- strand)
Length: 252
>GLEAN_7065 class=GenePrediction position=GCSC_140:4386296..4385543 (- strand)
ATGCAGCCCATCATTGTTGGGACTTTGGCCCTCGGCCTCTTAGCAACCGGTGGCGCAGCTTCCCCGGTGCCTATGCCGAC
TCCGGTAAGCTAAGAGGCAGCATACTTTGCTACCATTGAGGCGTCCTTATACTAATCTTATGCTTATCAAAAAGCCTGGC
CTTCCTACCGCAACAACCGCCAAGTCCCTCCTATCTGGCCTGACTGTGGCTGCGTACACGGATGACGGCGAGTACAAGCG
TACTCTGTTCCCGACTTGGGACACAATTGAAGGAACCTGCAACACTAGAGAATATGTGCTCAAGCGGGACGGTACCGACG
TCGTGACCAACTCGGCCTGCGTCGCGACATCTGGTAGCTGGCTGAGTCCGTACGATGGCGCCACGTGGACCGCCGTGTCC
GATCTTGACATCGATCACATGGTCCCGCTTAAGAATGCCTGGAACGTAAGTAATGGCGAGTTATATGATTAGGTGCCTGA
TTTTTAAACTAACGACATCCAGTCCGGCGCAAATGCGTGGACAACAGCGAAGCGTGAGCAGTTCGCCAACGATGTTACGC
GTCCACAGCTGTGGGCGGTCACGGATAACGTCAACGAGGCCAAGGGGGACAAGAGCCCAGACGCATGGAAGCCGCCGCTG
TCTTCGTTTTACTGCACGTATGCGCGCGCGTGGGTGGAGGTTAAAAGCTACTGGGACCTTAGCATCACGACAGCGGAGAA
GTCGGCGCTGTCATCTATGCTGAACACTTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62