GenePrediction:GLEAN_7068 Details

Name: GLEAN_7068
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4357104..4356216 (- strand)
Length: 889
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4357104..4356844 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_140:4356722..4356216 (- strand)
Length: 507
>GLEAN_7068 class=GenePrediction position=GCSC_140:4357104..4356216 (- strand)
ATGTGGAACTTCTGTCCTAATATCGGCGCATCTGCCATCTTTCTCACCCTCTTCATTCTCACCACGGCCGCCGATCTCGC
CCAGGTCATTCGCTTCCAGAAAACCTACTGCTGGGTCATAGTCATGTCCGGAGTGTGGCAGGTTCTGTCGTACATCTTCC
GTACTGCCAGAATTGAGGCACCTGCCAGCTTTGGCATGTACGCGTCCTGGTTTGTTCTCATCCTGGTGACCCCACTGGGG
ACCAACGCCTTTACCTACGACGTACATAGTCTTCGGCCAGCTCGTATGGAACCAAACGGCGGACCGTAAGTTTTGGGGCC
TGGGGGCCGTCTGGTTTAGTACTGTTTTTATCGTGTTTGACATCATCGCCTTCATCATCCAGGTCTACGGAGCAGCACAG
GCGACAGGAAGCAACGTCAGCCAGTATGACATTTTCAAGGGCCTTCACATCTACATGGTTGGCGTTGGCACCCAGTTGTT
GTGTATCCTCGTCTGTGGCAGCTTTAGCATCAAGTTGTTCACTGTCATGTGGGCCACTGGCGACAAGCAGAGCTCACTAT
GCGTCTTATTTTCACCCAGTTCTTGGCTATGGTGCTCATCATTGTCAAGTTCCCCCGTTTCGATGACTTTTTCAGCTGTG
TCCCTAGCTAGCACTATCTATTTTTCGCCCCAGAGTCGCATCTTGTTTCGTATCGTTGAGTACTCGAGCGGCATCGACAG
CAGTTTCCCTAACCATGAAGCTTTCCATTATTGCTTAGATTCATTGACAATGTTTGTTGCACTCGTGCTGTACAAAATCG
TGCACCCTGGCCGCATCTTTCGCGGCCCGGAGACCGAAATGCCTTCAACCTGGGTGAAGTGGAAGAAATGGTTCAGCATA
AATTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62