GenePrediction:GLEAN_7069 Details

Name: GLEAN_7069
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4348558..4346387 (- strand)
Length: 2172
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4348558..4348207 (- strand)
Length: 352
Type: CDS
Source: GLEAN
Position: GCSC_140:4348041..4346387 (- strand)
Length: 1655
>GLEAN_7069 class=GenePrediction position=GCSC_140:4348558..4346387 (- strand)
ATGGACGACACATCGACCCCGACCAACGAGACGTTTGCTGGCAATGCTCTCGCGGCTCAAAAACCGCTCCCTTCCTCTTT
CTCCGATTTTTCCGAGCCACCGCAGACTGCCGACTCTCCGAACGACAAGTTGCTGCACTCCTACGGAGAAAAAACCCATG
GCGTCAGGAAATCGCGCGATCCGTCCGACATGAACATCGATGACTCTGATGGCGAGATGGGCCATGGTGACGACGCTGCC
GGCCTATCCGACGAAGAGAGCATCGCCGCCGATGGCAAGGCAAACAAGAAGAAGAAGTCGCTGCGCTTCTACTGCACCGA
CTATCCCCCCTGCAATCTCAGCTTCACGAGAAGTGAGCATCTTGCTCGACACATACGGTAGGCCTCCCCCTCGCTTTCTT
ACTCAACCTGCTATCTGCTTGTCCTGTCCGCGAAAGCGTATTTACTAATTTGAATCAGAAAACACACTGGAGAACGACCA
TTCCAGTGCCACTGCTCGAGGCGCTTTTCCCGCCTAGACAACCTACGCCAACATGCCCAGACAGTCCACGTCAACGAGGA
CATTCCGATGGACTCTCTTGCCGCAACTGGTACTCGCTTTCAGCGGCAAATTCGCACAGACCGCGTCCGCGCTACTTCCG
GCCGGGCAAGAACGTCCACCACCGGCGCCATGGGCACGCCCACCCGTGGCCACTCCAAGTCGCTGTCCACGTCCAGCATA
ACCAGCGTCAGTTCCGTTGCCTCGTCTGTCTTCTCACCACGTGACGACCTGCGCCGACGACCACCCCCGCTCGTAATGGC
GGACCCCCGTGTGGCCCCATATCGTTCAGGTGCACACGACAATCAGTATCGGCCTCTCACCCCTACTGATTATGCCAGCC
CACCCTCTGCTACCTTTTCCAACGGTCCGGGCAGTCCGCGTTGGGGCCAGGGTCAGGCCATCGTCTCGCCGTCGCCGTCG
CACAGCCGCGCTCAGAGCATGTATGTCTCTGGCGTGCGAACCCCCGGCCGGCGTCTAAGCGTCCCGTCCTCGACTACAGA
CCCCTTCTTGTCTCCCCAGAACACAACGTTTGGCCGTCCGCTGTTCAGCCCAGGATGTATGAATGCTTCCAACGGCGGTC
TTTTCTCTCCCCCTAATGCTGGCAGTGTTCTGGCGTCACCGACAACGTCGACAACGTCTACCTGGTCAAGACGGGACTCC
ACGTCCACCGTTTCCGACGATGCCTGGCGTCGCCGGACCTGGCACCCTGACACGCGAGAGTACAATGCGATCAATAACGG
CTCCGGTAGCAGCCATTTAAGCCGTGTCGTTTCGTCTTCACAGTACCAGACTCCACCGACTGCATCCGTTCCGCTTGCCA
ACCCGGCAGCCCAACAAACAAACCTGCGCCTGCCAGGCATCGAGTCTTTCGACCCCCTTCCTCGGCATCGCCCCGGTTCA
CCGCCCCGCAGGGCGCCAACGCCTATGGCAATCGACTTGAACAACGGCCTTGTTGCTGGCCGGCCAACATCCATCTTGCG
AAATCATATGGAACCTGGCCAGGATGACCGCCGGGCACCGGTGAATAGCCAGTGGGATGTGCCTCTACATCGCAATTTGA
CAAGGTTGGAGATTGCGTCGAGCACGTCGCCACGCGACGGGGCTAGTGCTTGGGCTAGTGAGGCCAGTCGCACCGCGGTG
GCACAGGCCGAACAGTCTGATAGAAACACCCACCAACGGCAGCTTCAGCCGAGCGTCCGGTTCGAAGATGATATTCGGAC
TGCGCCCTCACGCTACGGTGCTCCTGACCCGACGCCTGTCGGATACAGCAGAGGACACTACCATACTGTGTCAGCACCAT
CCTTCAACATCACCACGCCACGTCACCAAAAGCGCCAGGGCTGGTACCAGGGCCCTCCACCGGCCACTGCGAATTTTGAA
TCCGAGCGTGCATCTGGCCCACGTGTCGACCGTATGGTGCACCCCAATTTAGCAAGCGGCTTTCAAGGCTTCCCTGCACG
TGTACCGCAGACTGTCCATGAACACCGGCAACAGGCAGCACCTCAACCTTCCGAACCTCAGCGATACTCCCAACAACAAC
AGCAAGAACAAGACCCACCTAACTCGCTAAGGCGCCTCGAGGCGCTGGTGGCAGTTGCCACTAGTGAAGTCTCTACCGCT
GCCGCCTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62