GenePrediction:GLEAN_706 Details

Name: GLEAN_706
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1548413..1549321 (+ strand)
Length: 909
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1548413..1548484 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_97:1548562..1548776 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_97:1548877..1549321 (+ strand)
Length: 445
>GLEAN_706 class=GenePrediction position=GCSC_97:1548413..1549321 (+ strand)
ATGTCCGCACTTGTGGAGGTTATCGCTAAGAAGGCACTCAAAAACGCTGCCACAAAAAACATCAACTCAAAGGTACACCG
CTCGGCCCCCAATGCAACTCAAATGCCAGCTGCACCTCGTTCCGCTGCAATCGCTAACACAAGCTTCAGGATCCGTTTTT
CGAAGATGTCCCCATCTACGGTCGTGACGGCCGTCCAACCGGCAAGGTCAAGAAGCAGAAGAAGGGCGTCCCCGCCGGCC
TCTCTGAGAAGGATGCCAAGGTCTTGAAGAAGGTGCGCAGACGGGCGTACCGTCTGGACATGAGCCTGTTCAACTGCTGC
GGCATTCGCTTCGGCTGGAGCAGTGTTGTCGGCTTCATTCCTGTGTAAGCTTTTTCTCCATTCAGATAAGGGACATTGAC
GTCATTGGCCCTATCCCGGTTGCATCACGCCACGCAGATGTGCTAACTGCAACCCTGTCTTTAGTATCGGTGACTTCATA
GACGTCTTCATGGCCTACATGGTAGTCCAGGCCTGTCGTGACGTTGACGGCGGCCTGCCGACGGCCATTCTGTCTCGCAT
GTACTTCAACATCATTGTTGACTTTGCGGTCGGCCTCGTGCCTTTCGTCGGTGACATCGCCGATGCCATCTTCCGTGCCA
ACACGCGCAACGCGTGGATCCTCGAGGAGTACCTCACCCAGAAGGCCGAAGAGGAGTTTAGGCGTGGAAAGAAAATTCTT
AATTCTGACCTCGCGGATGGAGACTCTCTTGGCTCTAGCTCTGGACCGAGGACGGCACCCCAATCAAGTAAGCAGTCCAA
GTTGCCGCGGGGCGGCAATGGTGCTCAGGACTCGTACCTGACCGACCAGGAGATGGGGGTGCAATCCCGAGACGAAAGAC
AAGACAGGCGCTATCAGGGCAGACATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62