GenePrediction:GLEAN_7072 Details

Name: GLEAN_7072
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4339382..4338394 (- strand)
Length: 989
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4339382..4339020 (- strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_140:4338966..4338394 (- strand)
Length: 573
>GLEAN_7072 class=GenePrediction position=GCSC_140:4339382..4338394 (- strand)
ATGGCCGACGTACCGACAATGAATGCTGGTGTTCCAGAGCCATTTGAACGGCTGGGAAGCCGTCTGCATCGGGCTGTTCA
TGCCGCGCATTTTCCACTCTATGGCATCTACTATTTTGTGCGCCGACCGTTCTTCTATCCGCTGTTCATTGGGCGTCTGC
TGCCCCTCTCCATCATCTCCTTTCTGGTTTATCTCCTCCTGTTTGCCTTTGCCTTTCTTCCGCAGTTTGCGTTCCTCGCC
ATCTTCCACGGCTGGGGTGCCTGGTTCAATGCCATCGTGCTCGTCCTGGGTGAGGGTCTGGTCATAATCCAGGGTCTCTT
TGAGGGCTTCTTTGTCGACGAGTGCCGGGTAGACGTGTTTGATGTGAGGTTTCCTGTTTTCCCTTTCGGCTTCAGTGTTT
CGCATCCCGCTCACAGATAGGTTTGCAGGCCACCCTTATCGACCAGGGCTGCATCGGCCTGGTGGCTCCACAGCGACTGC
TCACCCCGGATGCGCCCAATCCCGTCCGCATGCTCGGCCAACCTACCGCCTCGGCTGCTTACCAGCCCTGGAGCATAGTC
CAGATCGCGGAGCTGGCCGTCTGTCTGCCCCTCAACCTTATCCCCTATGTTGGCACGCCTGCCTTCATCCTCATCACCGG
CACCCGCCTCGGCAAACTCTCACAGTACCGCTGGTACAAGCTGCGCGGCCTCACCCGTAAGGAGCGCCAGCGCGAAATCC
GTACCCGCATTTGGGACTACACCTGGTTCGGCTCCGTCGCCATGATCCTCGAGCTGATTCCTATCTTCTCCTTCTTCTTC
CTGCTGACAAGTGCCGCCGCCGCTGCCCTTTGGGTGGCCGAAATGGAGAAGCGGGTCCCCAGCTTTGTCGCCTCCGACAC
CTCTGCTCCGACAGTTCAAGCCGCGAATTTTGCAGAAGCCGTCCAGAGCACGTCTGTCCCTGGGAGTGAGACGGCAGCTG
CCGTCCACTATGAGGACAACTTTGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62