GenePrediction:GLEAN_7073 Details

Name: GLEAN_7073
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4334950..4333364 (- strand)
Length: 1587
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4334950..4334715 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_140:4334591..4333973 (- strand)
Length: 619
Type: CDS
Source: GLEAN
Position: GCSC_140:4333915..4333364 (- strand)
Length: 552
>GLEAN_7073 class=GenePrediction position=GCSC_140:4334950..4333364 (- strand)
ATGAGCCAGCAGTGGCCAGACGTCAGCGTCGATGCCGAGAAAGCCGTTTTCTTCTCCCCATCGAGCTCGTATGACTCGGC
AAAGAAGTTTGACAGCGTGACACGGGAAGACGGCGAAGCTGGCGCCACAGACGAGACATCTCCTGCCGGCGTCCTTGGCC
GGGTGTTGAGCAGAGCTAGCTCGAGGACGTCCCATCCTAGCCCACCCCCCGACGGTGGCTGGAGAGCATGGAAAACGTGT
GTGTGAATTGTGTCTATGGTGCGACTCCGGTCTGCGTCGACATGGCTGACATGTTGCTAGGTATCTGTGTGCACGTTGCA
ATTATGAACACTTGGTATGCCATTCTCCTGAAGTCACAGCCGTCCGGCTTCCCTCTCTTCTGACTCGAGAACAAGGGGCG
TGATCAATTCGTTTGGCACATTCCAGACATACTACACGAACGCTCTGCATCGCGCCCCGTCAGACATCTCTTGGATCGGG
TCGTTCCAGATTTTCCTCCTCTTCTTCATCGGCACCTTCACCGGCCGGCTGACTGATGCGGGCTATTTTCGTTTGGTTGT
GACGGTCGGCATCGCACTGCTCGCACTCGGTGCCTTCACGACCGCGCAAGGGACGCAATACTGGCACTTTTTTTTGTCAC
AGGGCGTGGCTACCGGGCTCGGCAACGGCTGCATCTTCTGTCCCTGCCTGGCTGTGCTGAGCACGTACTTCAGCTCCAAG
CGCGGGCTAGCCATTGGCCTCGCCGCTTGTGGAAGCGCCACAGGCGGCCTTGTCTACCCCAGCATCGTCCGCCAGCTGCT
GCCGCGGCTGGGCTTCCCGTGGACCATGCGGGTCATTGGCTTCATCCAGTTTGCCACCATGGTGGCAGCCAGTCTCGGTA
TCGTCCCGCGGCTGCCACCCCGTCGCGACGATAAGATTGTCGAGTGGGCTGCCTTCCGCGAGCTGCAGTATACCTTTTAT
GCGGCAGGCACTTTCTGTGTGAGTGCTTGGTTTTATGCCACTTCCCTTTCACCTCCCCATATGCTGACAGCCCAGTGCTT
ATGGGGGGTCTATGTTGTCTACTTCTACGTCGCCTCGTTTAGCCGTGACGTGATCGGCCTGAGCTACACAGCCTCGCTCG
GCCTGCTCCTCGTCGTGAACGGTGTCGGCATCATCGGCCGGGTGCTTCCCAACTACATTGCAGACCGCTACGGCGTCCTC
AACTTGTTTCTCATCGTCGGTGCCCTCTGCGGCATCATAGCCCTGTGCTGGACCGCGGTGGATAGCCAGGGCGGCCTCTA
TGCCTGGGCGGCTGTGTATGGCATCTTTGCCGGCGGCGTCCAGTCCTTGTTCCCGGCCGGCCTAACTAGCCTGACGACCG
ACCTGAGCAAGTCAGGCGTGCGCATGGGCATGGTTTTTACGATCAACAGCTTTGCCACGCTGACGGGGTCGCCCATTGCC
GGGGCCATCATCTCGTCAAAGGGGGGGTCATACACGGGCGCCCAGGTGTTCACGGGCGTGACGCTGCTCGTCGGAACCTG
CTTCATCTTTGCAGCGAAGATGGTGCTGAGCAGGCAGCATGAGAGCGGCTGGATGGCAAAGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62