GenePrediction:GLEAN_707 Details

Name: GLEAN_707
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1550763..1552159 (+ strand)
Length: 1397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1550763..1550792 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_97:1550855..1551064 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_97:1551167..1551500 (+ strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_97:1551556..1552058 (+ strand)
Length: 503
Type: CDS
Source: GLEAN
Position: GCSC_97:1552100..1552159 (+ strand)
Length: 60
>GLEAN_707 class=GenePrediction position=GCSC_97:1550763..1552159 (+ strand)
ATGGCTTCCAACATGACCCCGTCCAAGATGGTAAGTCGCGTCGCGTCATATGACCCCTCTTTGTCGAACGGCTTCTAACG
TGTCTACTTCAGGCTGCTTCGGCTATTGAGTCGTTCACTATTGACTCTCCCGTCAAGAAGCTGGACTTTGGCGCCGCGAA
GACCGCGGAGGTGAAGAAGTTTGTAGACGCCAAAGAGGAGAACAACACAGCAGTCTCTGCTATCAAGGCAGCTGAGGCAG
AGGAGCCCCTCCTGAAGGAGAACGCCCAGCGCTTTGTCCTGTTCCCCATCAAGTACCACGAGGTAAGTCTAACCACGACG
CGTATTGACGCGTCACATCGCGAATTTACGCGTTAAGTGGTCATTTAACAGGCAAGAGGCGTTGTATTAACATTTTTTAT
ATAGATTTGGCAAATGTACAAGAAGCACGAGGCTTCGTTCTGGACTGCCGAGGAAATTGATCTCTCCAAGGATCTGCACG
ATTGGAACAACCGTCTGAACGATGATGAGCGGTTCTTTGTCTCGCACATTCTGGCATTCTTTGCTGCCTCTGACGGCATT
GTCAACGAGAACCTGGTTGAGCGCTTCAGTGCCGAGGTCCAGGTGCCTGAGGCTCGCTGCTTCTACGGTTTCCAGATCAT
GATGGAGAACGTCCACTCGGAGACATACTCCCTGCTCATTGACACCTACATCAAGGATACTGCGCAGCGCACCCACCTTT
TCAATGCTATCGATACCAGTATGTATTGAGTTCAATTATTCTGCCTGCCTATCAAGTCACTGACATGTTGCAGTTCCTTG
CATCCGGAAGAAGGCCGACTGGGCTCTGAAGTGGATCTCGGACCGCGAGTCTACCTTCGCCCAGCGCTTAGTAGCTTTCG
CCGCCGTTGAGGGTATCTTCTTCAGCGGTGCCTTCTCCTCCATCTTCTGGCTGAAGAAGCGTGGCCTGATGCCTGGCCTG
ACCTTCTCGAACGAGCTCATTTCCCGTGACGAGGGTCTGCACACCGACTTTGCCTGCCTGCTTTTCTCGCATCTCAAGAA
CCGCCCCAGCAAGCAGCTGATCGAGGAGATCATTGTCGATGCTGTCAAGATTGAGCAGGAGTTCCTGACCGAGGCGCTTC
CATGTGCTCTTCTCGGCATGAACTCTACGCTCATGAAGCAGTACATTGAGTTCGTTGCCGACCGCCTGCTAGTTGCTCTT
GGCAATGACAAGGTGTACAACTCCACCAACCCCTTCGACTTCATGGAGAACATCTCCCTGGGTGGCAAGACCAACTTCTT
TGAGAAGCGCGTCCCGGTGACTACCAGAAGGCCGGTGTCATGGCTGGCACCAAGAAGGAGGAGGCGCCCGTTGAAAACGT
CGACGGTGGCAACTTCAACTTCGACGAGGACTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62