GenePrediction:GLEAN_708 Details

Name: GLEAN_708
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1555935..1556996 (+ strand)
Length: 1062
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1555935..1555951 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_97:1556015..1556691 (+ strand)
Length: 677
Type: CDS
Source: GLEAN
Position: GCSC_97:1556758..1556996 (+ strand)
Length: 239
>GLEAN_708 class=GenePrediction position=GCSC_97:1555935..1556996 (+ strand)
ATGTCGACAACAGCAGGGTATGTCCTTGCTCTGCCATTGTCCCTCGGGCTCCAACAGCCAGACTGACCGGATGGTGACAG
CGCCTTTCTCGCCGGCGGCATTGCTGCCTGTGGTGCCGTGACGGCGACGCACCCGTTTGAGACGGTCAAGATCCGCATGC
AGTTGCAGGGCGAGCTGCAGTCCAAGGGCCACCAGCCGCATCACTACCGCGGGCCCATTCACGGAGTCTCGGTGATCTTG
CGCAACGAGGGCATTCGCGGAATCTATCGCGGCATCAGCTGCGCCTATGCCTACCAGATCCTGCTCAACGGCTGCCGTCT
GGGCTTCTACGAGCCCATGCGCAAGAGCCTATCCGGCCTGCTGTACCGCAACGACGCTGTCCAGAGCCTGCCGATCAACA
TGTTCTGCGGCGCCGCGTCCGGCATCATCGGTGCCGCTGCTGGCAGTCCCTTTTTCCTCGTCAAGACGCGCCTCCAGAGC
TTCTCTCCCTTCTTTCCCGTCGGCACCCAGCACAAGTACCGCAACGCCCTCGACGGCGTGCGCCAGATCCACCAGGCCGA
TGGCCTGCGTGGGCTCTACCGCGGCGTCAGCGCCGCTATGATCCGCACCGGCTTCGGCAGTTCCGTCCAGCTGCCCACAT
ACTTCTTCGCCAAGCGCCGCCTGCAGAAGCACTTCGGCATGACCGAGGGCCCCGCTCTGCACCTGACCAGCAGTGCCGCC
AGCGGCTGCGTCGTCTGCGTCGTCATGCACCCTCCAGGTGAGCTTCTCCTGGGCCCTGTCCTAGGCCCTTAGCCAGCTGC
TGACCCGTCTCCCTTTCTACCAGATACCATCATGTCCCGCATGTACAACCAGAACGGCAATCTCTACTCTGGCGTCTTCG
ACTGCCTGGCCAAGACCATTCGCACAGAGGGATTCTTCGCCATCTACAAGGGCGTCTTGCCGCATCTAGCTCGGATATTG
CCGCACACGATCTTGACCTTGTCGCTAGCCGAGCAGACCAACAAGCTGGTTCGCAAGATCGAGGATCGTCTCCTGTCCAG
GCCCACGTCCGAGATCGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62