GenePrediction:GLEAN_70 Details

Name: GLEAN_70
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:458700..461072 (+ strand)
Length: 2373
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:458700..459970 (+ strand)
Length: 1271
Type: CDS
Source: GLEAN
Position: GCSC_179:460074..460392 (+ strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_179:460461..461072 (+ strand)
Length: 612
>GLEAN_70 class=GenePrediction position=GCSC_179:458700..461072 (+ strand)
ATGGCATCAGAAGTCGATGACTGTTCGGCAAGGTTGCTGATAGCTGCTCGCACCGGGCGGCTCTCCCAAGCGCGACACCT
GCTTAACGAAAACGCCGACCCCAGTTTTCACACAGGTAATGGATGGACTCCTTTGCATGCGGCATCCTGGAATGGGCACC
CGGAAATCGTGAAGCTGCTCATCCAGCATCATGCCTCCCTTGAGATTAAATACAAGACCCGCACACCACTACAAAAGGCC
GCAGAACGCGGGTATCTCGAAATAGTTCGGATACTGATAGATGGCGGAGCCAACGTTGAGGCAGGAGCCACGGATGGCTT
TACGCCGTTGTTTATTGCCGCGGACAAAGGTTTCGGCGCGGTCGTCACATTACTGCTTGACCACAATGCCAACGTCAACG
CCTCTACCGCATATGGTTGGACTAGTCTTCATAGGGCTTCATACTCTGGAAGGCCACCAGTCGTGGAGATCCTGGTCCAG
CGTGGTGCCAACATCAATGCTTCTACCGTGGATGGTTGGACTAGTCTTCATAGTGCTTCATACTATGGAAAACTACCAGT
CGTGAGGATCCTGGTCCAGTCTGGTGCCGACACGGAGGCTCTGTTCAGGGGTAGCCGAACGCCCCTTCATAAGGCAGCAG
AGGCGGGCCACGCTGAGATAGTTCAGGTACTACTCGAAGGGAAAGCCGACATTAACGCCAGGGCCAATGACTGCCAAACG
TCCCTCCACCTGGCCGCGACAGAAGGCCATGTCGCTGTCGTAAGACTGTTGCTTGAGCGTGGAATCGCAGTTGATACTCG
AACTGTTCTCGGAGCGACTCCCTTACACATAGCTGCAAACAGTGGGAAGAAGGCGATCGTGGAGATGCTCCTTCAGAAGA
ACCCACCGCTGGAAGCAGAGTTGGACAAAAGCCACTTTACAGCACTCCATCAAGCGGCAGAAGGGGGGTTTGCCGACATT
GTCGACCTCTTGCTGAACCATGGAGCGGATATCGAGGCAAGGAGTGTTGACAGTTCCACCCCGTTGCATCTAGCCGCCTC
CAAAGGGCACGCGAAAGTGGTCAAGTTGCTGTTGGAGCGGCACGCCAAACAGACGGCCAAGAATAAAGCTCTGAAGAAGC
CTCTAGCCCTTGCCGAGGACAATCACCATACTCAAGTAATCACCTTGCTATCAGCTACGGATCAGCAGGATGATAGCGAA
TCATCCAGCATGGGTTCTATGCCCGATATTCATAGCCGGACTAACGACGCAAGTTTTCTTGCCGGTGAAAAGTGAGTACA
CGTCATTCCTGGCCGTCATTTTGTATATATATTAATGCCATTCCTCCCATCATTGCAGGCAAAGCGCAGCTACATGGCTT
TGTCAGATTGACAGATACAACGACCTCATCAAGTCTGCCGTCGTCAAGGCAAACAAGACTGCGTCTCCGGTCAAGATTGC
TGTGATTGATACGGGCTGCAGCACGAAAGCCGACTACTTCAACATCTGCCCCAGGGAAAGTAAACGTATCATGGGCAATC
ACTGGCGCGATTTCGCGGGGTCGGAATCGAGCCCGATTGACGAGGACATAAGTAAACATGGCACTATGGTTTCAGTGCTG
CTCCTCAGGGTGGCCAAGAATGCCGAGATATTCGTTGCCCGCATTGCAAAGACAGAGTCTGAGTTAGAGAGTGCAGCAGG
CAATATAGAAAAAGTGAGCAGTCCCAACCCTCGACTTACAGGGTTTAGCATCGGACCTAGCCAACTGACGAGAGAGTGCA
GGCCATTCAACACGCACAAGACCCGAAAGGATGGAATGTGGACATTATCTGCATGTCATTTGGGTTTAGGAAGGAAGTCG
CATCGATTAAGAAGGCAATAAGGAAGGCCAATTTTGACAACAATTCAATCGTGTTTTTCGCCGCTGCCGCAAATCAAGGC
TCCAACGAACCGGAGATGTTTCCTGCCTCCCTGTCCGAAGTCATCTCAGTGCGAGGAACGGATCACTATGGGACCTTCGT
TGGTGCCTACAACCCTCCCCCAGTGTCGACAAACAGCGGCCTCCCTCTCTTCGGTACACTAGGACAGGACGTTCCAACAT
TCGCGTCGTCAGGGAGCAGCAACGGGTGCTCGGTAGCTACCCCAATTATGGCTGGAATGGTCGCTATGGTCATGCAATGG
ATTGCGGAAAAGTCCGCCGATAAACGCGCCCTGCAACTGCTCCGAACCCCGGATGGAGTGCATGTGTTCCTAAAGAAAGC
GGCCTCGGTCGATAAGGGAAACAACCGGCGTTATGTTCATGTTTGGGATCTATTTGCCAATGGTGGGGAAAATTGTGTGA
AAAAGGTAGAGAGTGCCATGTCTGAGTTGTCCGCCCGTCAAACTGCTCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62