GenePrediction:GLEAN_7101 Details

Name: GLEAN_7101
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4214718..4214184 (- strand)
Length: 535
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4214718..4214544 (- strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_140:4214494..4214184 (- strand)
Length: 311
>GLEAN_7101 class=GenePrediction position=GCSC_140:4214718..4214184 (- strand)
ATGGCGCCAGACTTCAGTGGCCTGGAATGGGTGCGAAACCTCTGGGGCATCTCGCCTCGCTGGACGGTTGAATTGAACGG
CGAAGCCATCAAACTGACAATCCAGTCGGCACTCGAGCTTGCCGGCCTCTGTGATATCAAGGTTCTTGCAGGGGGCGAGT
CACAAGCTCTACGTCGTCAAATGCGCGGAAAAGGAACTCGTGGCACGAGTAACACTACCAATAGACCCGACCTGGAAGAC
CTTGAGCGAGGTGGCGACTCTGAAGTGGGTGCGCGCCAACACAAACCTTCCCGTTCCTGACGTCTTGGCGTACCAAGCCG
ACCGGGACAGCGCCATCGGGTTTGAGTGGATTGCTATGACTAAAATTCCCGGCAAACCGCTGGATGCCCTATGGAGGGAT
ATTGGCTTTTCTGCCAAGGAAGAAATTGTCCGCCAGCTTGCCTTATTCTGTTCCTGCACCTTTCTGACACAAATGCGCGG
TATTGGAAACCTGTTTCTGGAATCAACCGAAGCCAGATCCACACGAGCTCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62